Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0416Btlr/Mmmh
Stock Number:
038618-MU
Citation ID:
RRID:MMRRC_038618-MU
Other Names:
R0416 (G1), C57BL/6J-MtgxR0416Btlr
Major Collection:

Strain Information

Cd74
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: CLIP, Ii
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16149
VEGA: 18
HGNC: HGNC:1697
Homologene: 3209
Zmym1
Name: zinc finger, MYM domain containing 1
Synonyms: 5830412B09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68310
Homologene: 32904
Psmb1
Name: proteasome (prosome, macropain) subunit, beta type 1
Synonyms: Lmpc5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19170
VEGA: 17
HGNC: HGNC:9537
Homologene: 2087
U2surp
Name: U2 snRNP-associated SURP domain containing
Synonyms: 2610101N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67958
Homologene: 13964
Zc3h4
Name: zinc finger CCCH-type containing 4
Synonyms: LOC330474, Bwq1, Kiaa1064-hp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330474
Homologene: 87150
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Ddx19a
Name: DEAD box helicase 19a
Synonyms: Eif4a-rs1, DBP5, Ddx19, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13680
Homologene: 5240
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Stk3
Name: serine/threonine kinase 3
Synonyms: mess1, 0610042I06Rik, Mst2, MST, Ste20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56274
Homologene: 48420
Cep128
Name: centrosomal protein 128
Synonyms: 5430424K18Rik, 4930534B04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75216
Homologene: 35315
Polg
Name: polymerase (DNA directed), gamma
Synonyms: Pol gamma, polymerase gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, Polga
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18975
HGNC: HGNC:9179
Homologene: 2016
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: NALP3, Pypaf1, Mmig1, Cias1, cryopyrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216799
Homologene: 3600
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16880
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Nadk
Name: NAD kinase
Synonyms: 4432404C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192185
Homologene: 49724
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
F10
Name: coagulation factor X
Synonyms: fX, Cf10, AI194738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1203Clo, b2b1279Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Tapbp
Name: TAP binding protein
Synonyms: tapasin, TPN, D17Wsu91e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21356
Homologene: 2401
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Lrp12
Name: low density lipoprotein-related protein 12
Synonyms: C820005L12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239393
Homologene: 8385
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Tdrd5
Name: tudor domain containing 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214575
Homologene: 18312
Fam228b
Name: family with sequence similarity 228, member B
Synonyms: A830093I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207921
VEGA: 12
Homologene: 116108
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
Sik2
Name: salt inducible kinase 2
Synonyms: G630080D20Rik, Snf1lk2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235344
Homologene: 22875
Mthfsd
Name: methenyltetrahydrofolate synthetase domain containing
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234814
Homologene: 11245
Or2a56
Name: olfactory receptor family 2 subfamily A member 56
Synonyms: GA_x6K02T2P3E9-4602571-4601639, MOR261-2, Olfr444
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258650
Homologene: 88438
Trim30b
Name: tripartite motif-containing 30B
Synonyms: Trim30-1, A530023O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244183
Mrto4
Name: mRNA turnover 4, ribosome maturation factor
Synonyms: 2610012O22Rik, Mrt4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69902
Homologene: 6379
C330019G07Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Ptk6
Name: PTK6 protein tyrosine kinase 6
Synonyms: Sik, Tksk
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20459
HGNC: HGNC:9617
Homologene: 68494
Coil
Name: coilin
Synonyms: p80-coilin, Cln80
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12812
HGNC: HGNC:2184
Homologene: 3413
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Etv2
Name: ets variant 2
Synonyms: Etsrp71
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14008
HGNC: HGNC:3491
Homologene: 7308
Pip5kl1
Name: phosphatidylinositol-4-phosphate 5-kinase-like 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227733
Homologene: 45457
Adamdec1
Name: ADAM-like, decysin 1
Synonyms: 2210414L24Rik, Dcsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58860
VEGA: 14
Homologene: 8711
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: OSBP3, ORP3, 1200014M06Rik, 6720421I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71720
Homologene: 49422
Ap2s1
Name: adaptor-related protein complex 2, sigma 1 subunit
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232910
HGNC: HGNC:565
Homologene: 3001
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Serpinb3a
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
Synonyms: Sqn5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20248
Homologene: 76659
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Ergic2
Name: ERGIC and golgi 2
Synonyms: 4930572C01Rik, 1200009B18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67456
Homologene: 6574
Acsm2
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233799
Homologene: 70404
Ankrd44
Name: ankyrin repeat domain 44
Synonyms: E130014H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329154
Homologene: 27547
Gm9982
Name: predicted gene 9982
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Slc30a1
Name: solute carrier family 30 (zinc transporter), member 1
Synonyms: Znt1, C130040I11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22782
Homologene: 6681
Fbxw5
Name: F-box and WD-40 domain protein 5
Synonyms: Fbw5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30839
Homologene: 8496
Ndufs3
Name: NADH:ubiquinone oxidoreductase core subunit S3
Synonyms: 0610010M09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68349
HGNC: HGNC:7710
Homologene: 3346
Msi1
Name: musashi RNA-binding protein 1
Synonyms: m-Msi-1, Musahi1, Msi1, Msi1h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17690
HGNC: HGNC:7330
Homologene: 55657
Nlrx1
Name: NLR family member X1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270151
VEGA: 9
Homologene: 11623
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Or2t49
Name: olfactory receptor family 2 subfamily T member 49
Synonyms: GA_x6K02T2NKPP-912840-913784, MOR275-4, Olfr331
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100502887
Homologene: 133015
Ccl7
Name: C-C motif chemokine ligand 7
Synonyms: fic, marc, mcp3, MCP-3, Scya7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20306
Homologene: 133974
Mfsd11
Name: major facilitator superfamily domain containing 11
Synonyms: 2600014M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69900
Homologene: 11517
Gm4825
Name: predicted pseudogene 4825
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223745
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Glyat
Name: glycine-N-acyltransferase
Synonyms: A330009E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107146
Homologene: 64840
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 54,743,339 bp
  • G to T, chromosome 1 at 63,086,276 bp
  • C to A, chromosome 1 at 107,049,386 bp
  • T to C, chromosome 1 at 135,471,126 bp
  • T to C, chromosome 1 at 156,285,481 bp
  • T to A, chromosome 1 at 158,509,891 bp
  • T to A, chromosome 1 at 178,256,321 bp
  • C to T, chromosome 1 at 191,909,726 bp
  • C to T, chromosome 2 at 25,503,239 bp
  • A to T, chromosome 2 at 32,583,424 bp
  • A to G, chromosome 2 at 90,898,388 bp
  • T to C, chromosome 2 at 181,202,308 bp
  • A to G, chromosome 4 at 127,058,820 bp
  • A to T, chromosome 4 at 139,349,732 bp
  • C to A, chromosome 4 at 155,587,799 bp
  • T to A, chromosome 5 at 32,828,717 bp
  • T to C, chromosome 5 at 115,430,649 bp
  • T to C, chromosome 5 at 150,569,392 bp
  • G to A, chromosome 6 at 42,955,570 bp
  • C to T, chromosome 6 at 50,348,018 bp
  • A to T, chromosome 6 at 148,183,144 bp
  • T to G, chromosome 7 at 16,420,275 bp
  • C to A, chromosome 7 at 16,747,365 bp
  • T to C, chromosome 7 at 30,634,633 bp
  • A to G, chromosome 7 at 35,202,353 bp
  • T to A, chromosome 7 at 35,416,402 bp
  • A to G, chromosome 7 at 66,915,898 bp
  • T to C, chromosome 7 at 79,452,240 bp
  • A to T, chromosome 7 at 104,363,766 bp
  • A to T, chromosome 7 at 118,184,461 bp
  • A to G, chromosome 7 at 119,563,556 bp
  • CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG to CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG, chromosome 7 at 127,785,297 bp
  • G to A, chromosome 8 at 13,055,448 bp
  • T to C, chromosome 8 at 110,979,057 bp
  • T to C, chromosome 8 at 121,101,237 bp
  • T to C, chromosome 9 at 37,404,766 bp
  • T to G, chromosome 9 at 44,262,914 bp
  • A to T, chromosome 9 at 50,995,632 bp
  • T to A, chromosome 9 at 59,426,710 bp
  • A to T, chromosome 9 at 95,485,607 bp
  • A to T, chromosome 11 at 49,215,676 bp
  • T to A, chromosome 11 at 55,284,134 bp
  • T to C, chromosome 11 at 58,502,396 bp
  • T to C, chromosome 11 at 59,555,924 bp
  • T to A, chromosome 11 at 60,511,174 bp
  • C to T, chromosome 11 at 76,785,204 bp
  • C to A, chromosome 11 at 82,045,866 bp
  • T to C, chromosome 11 at 88,981,986 bp
  • A to G, chromosome 11 at 113,803,203 bp
  • T to A, chromosome 11 at 116,865,882 bp
  • T to A, chromosome 12 at 4,762,382 bp
  • A to T, chromosome 12 at 81,974,466 bp
  • A to G, chromosome 12 at 91,230,867 bp
  • A to T, chromosome 12 at 117,911,058 bp
  • T to G, chromosome 13 at 93,089,856 bp
  • T to C, chromosome 14 at 30,100,688 bp
  • T to G, chromosome 14 at 68,568,712 bp
  • T to C, chromosome 14 at 76,505,303 bp
  • A to T, chromosome 15 at 7,166,914 bp
  • T to A, chromosome 15 at 35,114,632 bp
  • G to T, chromosome 15 at 39,878,911 bp
  • T to C, chromosome 15 at 85,510,981 bp
  • C to T, chromosome 17 at 15,494,519 bp
  • C to T, chromosome 17 at 18,441,402 bp
  • A to G, chromosome 17 at 33,925,418 bp
  • A to T, chromosome 18 at 60,811,414 bp
  • G to A, chromosome 18 at 63,024,491 bp
  • T to C, chromosome 19 at 10,215,812 bp
  • G to A, chromosome 19 at 12,651,453 bp
  • G to T, chromosome 19 at 18,783,025 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0416 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038618-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.