Strain Name:
C57BL/6J-MtgxR0518Btlr/Mmmh
Stock Number:
038711-MU
Citation ID:
RRID:MMRRC_038711-MU
Other Names:
R0518 (G1), C57BL/6J-MtgxR0518Btlr
Major Collection:

Gene Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269614
Homologene: 41235
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269132
Homologene: 22865
Agt
Name: angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Sfrs16, Srsf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53609
Homologene: 134306
Bmerb1
Name: bMERB domain containing 1
Synonyms: MINP, 2900011O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67254
Homologene: 13236
Rps8
Name: ribosomal protein S8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20116
Homologene: 133143
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 321003
Mllt10
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
Synonyms: Af10, B130021D15Rik, D630001B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17354
Homologene: 20973
Ski
Name: ski sarcoma viral oncogene homolog (avian)
Synonyms: 2610001A11Rik, 2310012I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20481
Homologene: 31124
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Ddx4
Name: DEAD box helicase 4
Synonyms: mvh / m'vasa, VASA, Mvh, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Dhrs7b
Name: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216820
Homologene: 41044
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Rspry1
Name: ring finger and SPRY domain containing 1
Synonyms: 4930470D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67610
Homologene: 12164
Rab5b
Name: RAB5B, member RAS oncogene family
Synonyms: C030027M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19344
VEGA: 10
HGNC: HGNC:9784
Homologene: 104027
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276829
Homologene: 82367
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22772
Homologene: 5171
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Slc17a8
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
Synonyms: Vglut3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216227
Homologene: 13584
Ctsl
Name: cathepsin L
Synonyms: Cat L, major excreted protein, MEP, 1190035F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13039
VEGA: 13
HGNC: HGNC:2538
Homologene: 76699
Glb1
Name: galactosidase, beta 1
Synonyms: Bgs, Bge, Bgt, Bgl, Bgl-t, Bgl-s, Bgl-e, C130097A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Ptprs
Name: protein tyrosine phosphatase, receptor type, S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Rsrc1
Name: arginine/serine-rich coiled-coil 1
Synonyms: SRrp53, 1200013F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66880
Homologene: 41147
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Slc25a36
Name: solute carrier family 25, member 36
Synonyms: C330005L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 192287
Homologene: 10039
Cwc22
Name: CWC22 spliceosome-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 80744
Homologene: 6048
Ppan
Name: peter pan homolog
Synonyms: SSF1, A230087P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235036
HGNC: HGNC:9227
Homologene: 5690
Septin5
Name: septin 5
Synonyms: Cdcrel1, Pnutl1, Sept5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18951
VEGA: 16
HGNC: HGNC:9164
Homologene: 74446
Cyp2r1
Name: cytochrome P450, family 2, subfamily r, polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244209
Homologene: 75210
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: LOC380710, Garnl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380711
Homologene: 56695
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16532
Homologene: 7392
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56631
Homologene: 9387
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, diminished cone electroretinogram, dice, Cpfl8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Cryba2
Name: crystallin, beta A2
Synonyms: E130107M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12958
HGNC: HGNC:2395
Homologene: 10991
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Nipsnap3b
Name: nipsnap homolog 3B
Synonyms: 2700063N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66536
Homologene: 75044
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627537
Homologene: 129750
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232237
Homologene: 27798
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320429
Homologene: 45845
Pcsk6
Name: proprotein convertase subtilisin/kexin type 6
Synonyms: PACE4, SPC4, b2b2830Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18553
HGNC: HGNC:8569
Homologene: 20569
Ankrd33b
Name: ankyrin repeat domain 33B
Synonyms: 0610012A05Rik, 5730557B15Rik, 3021401C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67434
Homologene: 12362
Tdrd5
Name: tudor domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214575
Homologene: 18312
Olfr898
Name: olfactory receptor 898
Synonyms: GA_x6K02T2PVTD-32037624-32038565, MOR170-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258871
VEGA: 9
Homologene: 133654
Olfr714
Name: olfactory receptor 714
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259035
HGNC: HGNC:8161
Homologene: 72055
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242584
Homologene: 11702
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
P2ry14
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140795
Homologene: 15769
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215015
Homologene: 8909
Zfp628
Name: zinc finger protein 628
Synonyms: Zec
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232816
Homologene: 72200
Asic1
Name: acid-sensing (proton-gated) ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Capn5
Name: calpain 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12337
HGNC: HGNC:1482
Homologene: 31212
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242248
Homologene: 9926
Acsbg3
Name: acyl-CoA synthetase bubblegum family member 3
Synonyms: 1700061G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78625
Homologene: 28378
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382014
Homologene: 124473
Tfb2m
Name: transcription factor B2, mitochondrial
Synonyms: Hkp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15278
Homologene: 7362
Hdac7
Name: histone deacetylase 7
Synonyms: 5830434K02Rik, Hdac7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 56233
Homologene: 9124
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Olfr624
Name: olfactory receptor 624
Synonyms: GA_x6K02T2PBJ9-6394126-6393197, MOR4-2P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258189
Homologene: 66460
Ddx58
Name: DEAD/H box helicase 58
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230073
Homologene: 32215
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57913
Homologene: 11220
Ngly1
Name: N-glycanase 1
Synonyms: 1110002C09Rik, Png1, PNGase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 59007
Homologene: 10117
Ogfod1
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms: 4930415J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270086
Homologene: 41238
Cryzl2
Name: crystallin zeta like 2
Synonyms: quinone reductase-like 2, BC026585
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226527
Homologene: 41713
Atpsckmt
Name: ATP synthase C subunit lysine N-methyltransferase
Synonyms: A930016P21Rik, Fam173b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68073
Homologene: 16780
Vmn1r4
Name: vomeronasal 1 receptor 4
Synonyms: C230065D10Rik, V1rc21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171194
Homologene: 131060
Dnd1
Name: DND microRNA-mediated repression inhibitor 1
Synonyms: RBMS4, Ter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 213236
Homologene: 65262
Ms4a1
Name: membrane-spanning 4-domains, subfamily A, member 1
Synonyms: Ly-44, Cd20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12482
HGNC: HGNC:7315
Homologene: 7259
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Hk3
Name: hexokinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212032
HGNC: HGNC:4925
Homologene: 55633
Acsm5
Name: acyl-CoA synthetase medium-chain family member 5
Synonyms: C730027J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272428
Homologene: 69242
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Ppp1r26
Name: protein phosphatase 1, regulatory subunit 26
Synonyms: LOC241289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241289
Homologene: 49400
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100087
Homologene: 6347
Arhgef16
Name: Rho guanine nucleotide exchange factor (GEF) 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230972
Homologene: 82484
Tmem211
Name: transmembrane protein 211
Synonyms: LOC333048
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333048
Homologene: 52993
Rergl
Name: RERG/RAS-like
Synonyms: EG632971
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 632971
Homologene: 41583
Hsd3b7
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101502
Homologene: 41617
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21892
Homologene: 49202
Upk2
Name: uroplakin 2
Synonyms: uroplakin II, UPII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22269
VEGA: 9
Homologene: 4920
Gm9930
Name: predicted gene 9930
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Olfr1381
Name: olfactory receptor 1381
Synonyms: GA_x6K02T2QP88-5884501-5883566, MOR256-26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258461
Homologene: 72463
Scrn2
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217140
Homologene: 26698
Coa3
Name: cytochrome C oxidase assembly factor 3
Synonyms: 1810033A19Rik, D11Ertd99e, Ccdc56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 52469
Homologene: 69156
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105387
Homologene: 138093
Rab24
Name: RAB24, member RAS oncogene family
Synonyms: 6530406O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19336
VEGA: 13
HGNC: HGNC:9765
Homologene: 40641
Kng1
Name: kininogen 1
Synonyms: L-kininogen, H-kininigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16644
HGNC: HGNC:6383
Homologene: 88343
Ammecr1l
Name: AMME chromosomal region gene 1-like
Synonyms: 5430429D03Rik, E230022H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225339
VEGA: 18
Homologene: 69488
Foxb2
Name: forkhead box B2
Synonyms: Fkh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14240
VEGA: 19
Homologene: 136311
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,890,125 bp
  • T to A, chromosome 1 at 127,384,847 bp
  • C to A, chromosome 1 at 133,105,992 bp
  • C to A, chromosome 1 at 136,076,859 bp
  • G to T, chromosome 1 at 152,508,561 bp
  • C to A, chromosome 1 at 156,262,941 bp
  • C to A, chromosome 1 at 156,687,456 bp
  • T to C, chromosome 1 at 157,464,430 bp
  • T to C, chromosome 1 at 179,537,824 bp
  • T to G, chromosome 2 at 18,071,206 bp
  • A to G, chromosome 2 at 28,452,302 bp
  • A to G, chromosome 2 at 77,904,038 bp
  • A to G, chromosome 2 at 157,163,533 bp
  • T to A, chromosome 3 at 59,115,204 bp
  • T to C, chromosome 3 at 67,351,684 bp
  • C to T, chromosome 3 at 136,213,942 bp
  • C to T, chromosome 4 at 40,216,354 bp
  • T to A, chromosome 4 at 53,021,343 bp
  • T to C, chromosome 4 at 58,145,151 bp
  • A to C, chromosome 4 at 103,064,530 bp
  • T to A, chromosome 4 at 108,848,579 bp
  • C to G, chromosome 4 at 117,154,285 bp
  • G to T, chromosome 4 at 154,291,034 bp
  • A to T, chromosome 4 at 154,976,625 bp
  • A to G, chromosome 4 at 155,159,286 bp
  • T to A, chromosome 5 at 113,236,007 bp
  • A to G, chromosome 6 at 31,468,132 bp
  • G to T, chromosome 6 at 56,956,898 bp
  • C to T, chromosome 6 at 92,038,178 bp
  • T to G, chromosome 6 at 139,496,526 bp
  • A to T, chromosome 7 at 4,919,940 bp
  • T to C, chromosome 7 at 6,711,428 bp
  • A to G, chromosome 7 at 19,588,603 bp
  • T to A, chromosome 7 at 65,980,167 bp
  • C to T, chromosome 7 at 98,132,882 bp
  • T to A, chromosome 7 at 103,670,489 bp
  • T to A, chromosome 7 at 107,074,758 bp
  • T to G, chromosome 7 at 114,552,900 bp
  • T to C, chromosome 7 at 119,535,800 bp
  • A to G, chromosome 7 at 127,803,079 bp
  • T to C, chromosome 7 at 141,441,380 bp
  • T to G, chromosome 8 at 25,910,888 bp
  • T to G, chromosome 8 at 64,098,471 bp
  • A to T, chromosome 8 at 69,793,849 bp
  • A to T, chromosome 8 at 71,479,258 bp
  • T to A, chromosome 8 at 94,055,248 bp
  • T to A, chromosome 8 at 94,629,746 bp
  • C to A, chromosome 8 at 124,557,100 bp
  • T to C, chromosome 9 at 20,889,766 bp
  • A to C, chromosome 9 at 38,349,203 bp
  • G to T, chromosome 9 at 44,454,121 bp
  • A to T, chromosome 9 at 97,097,175 bp
  • A to C, chromosome 9 at 111,333,808 bp
  • ACCC to ACC, chromosome 9 at 114,421,744 bp
  • A to T, chromosome 10 at 9,534,803 bp
  • A to T, chromosome 10 at 19,759,640 bp
  • A to T, chromosome 10 at 61,862,746 bp
  • A to G, chromosome 10 at 89,576,330 bp
  • A to T, chromosome 10 at 128,682,817 bp
  • T to A, chromosome 11 at 3,685,963 bp
  • T to A, chromosome 11 at 46,360,288 bp
  • C to T, chromosome 11 at 49,552,464 bp
  • T to A, chromosome 11 at 58,968,494 bp
  • T to C, chromosome 11 at 60,857,710 bp
  • A to G, chromosome 11 at 72,404,013 bp
  • A to T, chromosome 11 at 74,441,766 bp
  • A to G, chromosome 11 at 84,290,286 bp
  • A to C, chromosome 11 at 97,031,068 bp
  • T to A, chromosome 11 at 101,278,890 bp
  • A to T, chromosome 12 at 70,346,585 bp
  • A to C, chromosome 12 at 76,108,862 bp
  • T to C, chromosome 13 at 4,081,016 bp
  • C to T, chromosome 13 at 55,014,426 bp
  • A to T, chromosome 13 at 55,320,925 bp
  • G to A, chromosome 13 at 64,365,218 bp
  • C to A, chromosome 13 at 95,443,895 bp
  • A to T, chromosome 13 at 112,624,779 bp
  • C to T, chromosome 14 at 16,290,774 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • T to C, chromosome 15 at 31,367,286 bp
  • T to G, chromosome 15 at 31,605,957 bp
  • T to G, chromosome 15 at 81,427,492 bp
  • G to A, chromosome 15 at 97,806,499 bp
  • C to T, chromosome 15 at 99,698,819 bp
  • T to A, chromosome 16 at 13,986,812 bp
  • T to C, chromosome 16 at 18,624,897 bp
  • G to A, chromosome 16 at 23,060,482 bp
  • A to T, chromosome 17 at 19,521,916 bp
  • A to G, chromosome 17 at 24,595,219 bp
  • A to G, chromosome 17 at 56,419,621 bp
  • T to A, chromosome 17 at 56,885,169 bp
  • A to T, chromosome 17 at 57,206,307 bp
  • A to T, chromosome 17 at 74,856,549 bp
  • A to T, chromosome 18 at 20,388,164 bp
  • C to T, chromosome 18 at 31,771,901 bp
  • A to G, chromosome 18 at 36,764,043 bp
  • C to A, chromosome 19 at 11,258,679 bp
  • G to T, chromosome 19 at 16,872,456 bp
  • A to T, chromosome Y at 1,307,880 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0518 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038711-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.