Strain Name:
C57BL/6J-MtgxR0521Btlr/Mmmh
Stock Number:
038714-MU
Citation ID:
RRID:MMRRC_038714-MU
Other Names:
R0521 (G1), C57BL/6J-MtgxR0521Btlr
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75560
Homologene: 38779
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Sfrs16, Srsf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53609
Homologene: 134306
Bmerb1
Name: bMERB domain containing 1
Synonyms: MINP, 2900011O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67254
Homologene: 13236
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Rtel1
Name: regulator of telomere elongation helicase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269400
Homologene: 13168
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Ctdspl2
Name: CTD small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329506
Homologene: 32311
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 321003
Nbea
Name: neurobeachin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Ddx4
Name: DEAD box helicase 4
Synonyms: mvh / m'vasa, VASA, Mvh, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Ddx54
Name: DEAD box helicase 54
Synonyms: APR-5, DP97, 2410015A15Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71990
Homologene: 5590
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 84505
Homologene: 32157
Nsmce4a
Name: NSE4 homolog A, SMC5-SMC6 complex component
Synonyms: 2410003A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67872
Homologene: 9745
Ccm2
Name: cerebral cavernous malformation 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216527
Homologene: 12868
Dhrs7b
Name: dehydrogenase/reductase 7B
Synonyms: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216820
Homologene: 41044
Cog7
Name: component of oligomeric golgi complex 7
Synonyms: 5630400E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233824
Homologene: 33431
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Rab5b
Name: RAB5B, member RAS oncogene family
Synonyms: C030027M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19344
VEGA: 10
HGNC: HGNC:9784
Homologene: 104027
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276829
Homologene: 82367
Zfp442
Name: zinc finger protein 442
Synonyms: OTTMUSG00000015730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668923
Homologene: 136215
Yipf1
Name: Yip1 domain family, member 1
Synonyms: C030002N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230584
Homologene: 5898
Uvssa
Name: UV stimulated scaffold protein A
Synonyms: D330017J19Rik, 4933407H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71101
Homologene: 13807
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22772
Homologene: 5171
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: 5830445G22Rik, Whsc1l, 9430010A17Rik, D030027O06Rik, C130020C13Rik, D930023B08Rik, Whsc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 107823
Homologene: 26175
Slc17a8
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
Synonyms: Vglut3, Vgt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216227
Homologene: 13584
Fev
Name: FEV transcription factor, ETS family member
Synonyms: mPet-1, Pet1, Pex1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 260298
Homologene: 9706
Ctsl
Name: cathepsin L
Synonyms: major excreted protein, MEP, Cat L, 1190035F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Ddost
Name: dolichyl-di-phosphooligosaccharide-protein glycotransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13200
HGNC: HGNC:2728
Homologene: 3821
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Clstn1
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65945
Homologene: 8814
Trerf1
Name: transcriptional regulating factor 1
Synonyms: Trep132, Trep-132, 9430096I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224829
Homologene: 14129
Foxn3
Name: forkhead box N3
Synonyms: HTLFL1, 5430426H20Rik, Ches1l, Ches1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71375
HGNC: HGNC:1928
Homologene: 135955
Septin5
Name: septin 5
Synonyms: Cdcrel1, Pnutl1, Sept5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18951
VEGA: 16
HGNC: HGNC:9164
Homologene: 74446
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: LOC380710, Garnl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380711
Homologene: 56695
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16532
Homologene: 7392
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56631
Homologene: 9387
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627537
Homologene: 129750
Entpd5
Name: ectonucleoside triphosphate diphosphohydrolase 5
Synonyms: mNTPase, NTPDase-5, ER-UDPase, NTPDase5, Cd39l4, Pcph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12499
HGNC: HGNC:3367
Homologene: 37457
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241514
Homologene: 18461
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Ankrd33b
Name: ankyrin repeat domain 33B
Synonyms: 0610012A05Rik, 5730557B15Rik, 3021401C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67434
Homologene: 12362
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy-1, Pgy1, Abcb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Or8c20
Name: olfactory receptor family 8 subfamily C member 20
Synonyms: GA_x6K02T2PVTD-32037624-32038565, MOR170-3, Olfr898
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258871
VEGA: 9
Homologene: 133654
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21846
Homologene: 3957
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4, Olfr714
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259035
Homologene: 72055
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Zfp628
Name: zinc finger protein 628
Synonyms: Zec
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232816
Homologene: 72200
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 435864
Homologene: 129606
Ces5a
Name: carboxylesterase 5A
Synonyms: LOC244598, 1700081L16Rik, 1700122C07Rik, cauxin, Ces7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67935
Homologene: 74305
Gsdma2
Name: gasdermin A2
Synonyms: 2210411P14Rik, 2210009F20Rik, 2200001G21Rik, Gsdml2, 2210006M16Rik, Gsdm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76758
Nfatc2ip
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
Synonyms: NIP45, D7Ertd304e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18020
Homologene: 7862
Hic1
Name: hypermethylated in cancer 1
Synonyms: HIC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15248
HGNC: HGNC:4909
Homologene: 4740
Or7e168
Name: olfactory receptor family 7 subfamily E member 168
Synonyms: GA_x6K02T2PVTD-13548326-13549255, MOR146-3, MOR146-10_p, Olfr859
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258519
Homologene: 134093
Xkr6
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219149
Homologene: 18287
Capn5
Name: calpain 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12337
HGNC: HGNC:1482
Homologene: 31212
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242248
Homologene: 9926
Acsbg3
Name: acyl-CoA synthetase bubblegum family member 3
Synonyms: 1700061G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78625
Homologene: 28378
Fsd1
Name: fibronectin type 3 and SPRY domain-containing protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240121
VEGA: 17
Homologene: 11531
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3, Olfr1099
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258764
Homologene: 107003
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382014
Homologene: 124473
Or4a2
Name: olfactory receptor family 4 subfamily A member 2
Synonyms: GA_x6K02T2Q125-50861284-50860367, MOR231-3, Olfr1239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258972
Homologene: 74244
Epb42
Name: erythrocyte membrane protein band 4.2
Synonyms: Epb4.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13828
HGNC: HGNC:3381
Homologene: 93
Ankrd16
Name: ankyrin repeat domain 16
Synonyms: D430029B21Rik, 2810455F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320816
Homologene: 19509
Hdac7
Name: histone deacetylase 7
Synonyms: 5830434K02Rik, Hdac7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 56233
Homologene: 9124
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Or51v8
Name: olfactory receptor family 51 subfamily V member 8
Synonyms: GA_x6K02T2PBJ9-6394126-6393197, MOR4-2P, Olfr624
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258189
Homologene: 66460
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57913
Homologene: 11220
Ifna6
Name: interferon alpha 6
Synonyms: Ifa6, Ifna8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15969
Homologene: 68536
Ngly1
Name: N-glycanase 1
Synonyms: 1110002C09Rik, Png1, PNGase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 59007
Homologene: 10117
Thnsl2
Name: threonine synthase-like 2 (bacterial)
Synonyms: TSH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232078
Homologene: 5489
Atpsckmt
Name: ATP synthase C subunit lysine N-methyltransferase
Synonyms: A930016P21Rik, Fam173b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68073
Homologene: 16780
Ms4a1
Name: membrane-spanning 4-domains, subfamily A, member 1
Synonyms: Ly-44, Cd20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12482
HGNC: HGNC:7315
Homologene: 7259
Hk3
Name: hexokinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212032
HGNC: HGNC:4925
Homologene: 55633
Bpifa5
Name: BPI fold containing family A, member 5
Synonyms: 2310074B19Rik, 2310021H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67135
Homologene: 12087
Rergl
Name: RERG/RAS-like
Synonyms: EG632971
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 632971
Homologene: 41583
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21892
Homologene: 49202
Upk2
Name: uroplakin 2
Synonyms: uroplakin II, UPII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22269
VEGA: 9
Homologene: 4920
Gm9930
Name: predicted gene 9930
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Or2y11
Name: olfactory receptor family 2 subfamily Y member 11
Synonyms: GA_x6K02T2QP88-5884501-5883566, MOR256-26, Olfr1381
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258461
Homologene: 72463
Rab24
Name: RAB24, member RAS oncogene family
Synonyms: 6530406O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19336
VEGA: 13
HGNC: HGNC:9765
Homologene: 40641
Kng1
Name: kininogen 1
Synonyms: L-kininogen, H-kininigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16644
HGNC: HGNC:6383
Homologene: 88343
Foxb2
Name: forkhead box B2
Synonyms: Fkh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14240
VEGA: 19
Homologene: 136311
Bcs1l
Name: BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone
Synonyms: 9130022O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66821
HGNC: HGNC:1020
Homologene: 3193
Wdr38
Name: WD repeat domain 38
Synonyms: 1700123D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76646
Homologene: 79011
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230883
Homologene: 28426
Mdfic
Name: MyoD family inhibitor domain containing
Synonyms: clone 1.5, Kdt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16543
Homologene: 18404
AC164610.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Fbxl9
Name: F-box and leucine-rich repeat protein 9
Synonyms: FBL9, A630024J02Rik, Lrrc29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234684
Homologene: 133339
Angel1
Name: angel homolog 1
Synonyms: 1110030H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68737
Homologene: 32251
Tnfaip8l1
Name: tumor necrosis factor, alpha-induced protein 8-like 1
Synonyms: 2600017J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66443
Homologene: 23547
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 67,215,564 bp
  • A to T, chromosome 1 at 74,590,466 bp
  • C to A, chromosome 1 at 74,882,533 bp
  • A to G, chromosome 1 at 93,576,821 bp
  • G to A, chromosome 1 at 128,193,703 bp
  • T to A, chromosome 1 at 134,618,033 bp
  • T to C, chromosome 2 at 11,789,881 bp
  • C to A, chromosome 2 at 35,010,086 bp
  • T to A, chromosome 2 at 39,001,151 bp
  • C to T, chromosome 2 at 82,259,417 bp
  • C to T, chromosome 2 at 86,958,846 bp
  • T to C, chromosome 2 at 89,418,200 bp
  • T to A, chromosome 2 at 121,029,150 bp
  • T to G, chromosome 2 at 121,305,753 bp
  • T to A, chromosome 2 at 122,006,887 bp
  • T to C, chromosome 2 at 150,411,249 bp
  • C to A, chromosome 2 at 154,166,949 bp
  • G to T, chromosome 2 at 181,349,451 bp
  • A to T, chromosome 3 at 56,008,268 bp
  • A to G, chromosome 3 at 95,338,829 bp
  • C to T, chromosome 3 at 136,213,942 bp
  • A to T, chromosome 4 at 88,629,322 bp
  • G to T, chromosome 4 at 88,827,650 bp
  • A to G, chromosome 4 at 107,336,190 bp
  • A to C, chromosome 4 at 118,476,146 bp
  • A to G, chromosome 4 at 138,310,735 bp
  • A to T, chromosome 4 at 144,455,894 bp
  • T to A, chromosome 4 at 149,614,187 bp
  • G to A, chromosome 5 at 8,864,238 bp
  • G to A, chromosome 5 at 33,411,679 bp
  • T to A, chromosome 5 at 33,843,338 bp
  • C to A, chromosome 5 at 108,848,288 bp
  • A to T, chromosome 5 at 110,726,959 bp
  • A to G, chromosome 5 at 120,626,862 bp
  • A to G, chromosome 6 at 15,799,756 bp
  • A to T, chromosome 6 at 71,134,259 bp
  • T to G, chromosome 6 at 133,531,231 bp
  • T to G, chromosome 6 at 139,496,526 bp
  • A to T, chromosome 7 at 4,919,940 bp
  • T to C, chromosome 7 at 6,711,428 bp
  • A to G, chromosome 7 at 19,588,603 bp
  • C to T, chromosome 7 at 98,132,882 bp
  • T to A, chromosome 7 at 103,670,489 bp
  • T to A, chromosome 7 at 107,074,758 bp
  • C to A, chromosome 7 at 121,941,169 bp
  • T to G, chromosome 7 at 126,396,579 bp
  • T to C, chromosome 7 at 130,537,002 bp
  • T to A, chromosome 7 at 135,143,778 bp
  • T to C, chromosome 7 at 141,441,380 bp
  • T to G, chromosome 8 at 25,910,888 bp
  • T to G, chromosome 8 at 64,098,471 bp
  • A to T, chromosome 8 at 69,793,849 bp
  • A to T, chromosome 8 at 71,479,258 bp
  • T to A, chromosome 8 at 93,525,658 bp
  • A to T, chromosome 8 at 105,312,793 bp
  • C to A, chromosome 8 at 124,557,100 bp
  • G to A, chromosome 9 at 19,808,860 bp
  • A to C, chromosome 9 at 38,349,203 bp
  • G to T, chromosome 9 at 44,454,121 bp
  • T to A, chromosome 9 at 59,894,352 bp
  • A to T, chromosome 10 at 9,534,803 bp
  • A to T, chromosome 10 at 19,759,640 bp
  • A to T, chromosome 10 at 61,862,746 bp
  • A to G, chromosome 10 at 89,576,330 bp
  • A to T, chromosome 10 at 128,682,817 bp
  • T to A, chromosome 11 at 3,685,963 bp
  • G to A, chromosome 11 at 6,590,886 bp
  • T to A, chromosome 11 at 46,360,288 bp
  • C to T, chromosome 11 at 49,552,464 bp
  • T to A, chromosome 11 at 58,968,494 bp
  • T to C, chromosome 11 at 60,857,710 bp
  • A to G, chromosome 11 at 72,404,013 bp
  • A to T, chromosome 11 at 74,441,766 bp
  • G to A, chromosome 11 at 75,166,887 bp
  • A to T, chromosome 11 at 98,654,901 bp
  • A to G, chromosome 12 at 84,405,393 bp
  • G to A, chromosome 12 at 86,722,907 bp
  • A to G, chromosome 12 at 99,209,506 bp
  • C to T, chromosome 13 at 55,014,426 bp
  • A to T, chromosome 13 at 55,320,925 bp
  • G to A, chromosome 13 at 64,365,218 bp
  • C to A, chromosome 13 at 95,443,895 bp
  • A to T, chromosome 13 at 112,624,779 bp
  • C to T, chromosome 14 at 16,290,774 bp
  • A to T, chromosome 14 at 63,819,422 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • T to C, chromosome 15 at 31,367,286 bp
  • T to G, chromosome 15 at 31,605,957 bp
  • T to G, chromosome 15 at 81,427,492 bp
  • G to A, chromosome 15 at 97,806,499 bp
  • C to T, chromosome 15 at 99,698,819 bp
  • T to A, chromosome 16 at 13,986,812 bp
  • T to C, chromosome 16 at 18,624,897 bp
  • G to A, chromosome 16 at 23,060,482 bp
  • A to T, chromosome 17 at 19,521,916 bp
  • A to G, chromosome 17 at 24,595,219 bp
  • A to T, chromosome 17 at 47,348,642 bp
  • A to G, chromosome 17 at 55,991,245 bp
  • A to T, chromosome 17 at 56,171,727 bp
  • T to A, chromosome 17 at 56,885,169 bp
  • A to T, chromosome 17 at 74,856,549 bp
  • G to A, chromosome 18 at 7,222,676 bp
  • T to A, chromosome 18 at 20,527,815 bp
  • C to A, chromosome 19 at 11,258,679 bp
  • G to T, chromosome 19 at 16,872,456 bp
  • A to T, chromosome Y at 1,307,880 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0521 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038714-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.