Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0521Btlr/Mmmh
Stock Number:
038714-MU
Citation ID:
RRID:MMRRC_038714-MU
Other Names:
R0521 (G1), C57BL/6J-MtgxR0521Btlr
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Srsf16, Sfrs16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53609
Homologene: 134306
Bmerb1
Name: bMERB domain containing 1
Synonyms: MINP, 2900011O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67254
Homologene: 13236
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 67,215,564 bp
  • A to T, chromosome 1 at 74,590,466 bp
  • C to A, chromosome 1 at 74,882,533 bp
  • A to G, chromosome 1 at 93,576,821 bp
  • G to A, chromosome 1 at 128,193,703 bp
  • T to A, chromosome 1 at 134,618,033 bp
  • T to C, chromosome 2 at 11,789,881 bp
  • C to A, chromosome 2 at 35,010,086 bp
  • T to A, chromosome 2 at 39,001,151 bp
  • C to T, chromosome 2 at 82,259,417 bp
  • C to T, chromosome 2 at 86,958,846 bp
  • T to C, chromosome 2 at 89,418,200 bp
  • T to A, chromosome 2 at 121,029,150 bp
  • T to G, chromosome 2 at 121,305,753 bp
  • T to A, chromosome 2 at 122,006,887 bp
  • T to C, chromosome 2 at 150,411,249 bp
  • C to A, chromosome 2 at 154,166,949 bp
  • G to T, chromosome 2 at 181,349,451 bp
  • A to T, chromosome 3 at 56,008,268 bp
  • A to G, chromosome 3 at 95,338,829 bp
  • C to T, chromosome 3 at 136,213,942 bp
  • A to T, chromosome 4 at 88,629,322 bp
  • G to T, chromosome 4 at 88,827,650 bp
  • A to G, chromosome 4 at 107,336,190 bp
  • A to C, chromosome 4 at 118,476,146 bp
  • A to G, chromosome 4 at 138,310,735 bp
  • A to T, chromosome 4 at 144,455,894 bp
  • T to A, chromosome 4 at 149,614,187 bp
  • G to A, chromosome 5 at 8,864,238 bp
  • G to A, chromosome 5 at 33,411,679 bp
  • T to A, chromosome 5 at 33,843,338 bp
  • C to A, chromosome 5 at 108,848,288 bp
  • A to T, chromosome 5 at 110,726,959 bp
  • A to G, chromosome 5 at 120,626,862 bp
  • A to G, chromosome 6 at 15,799,756 bp
  • A to T, chromosome 6 at 71,134,259 bp
  • T to G, chromosome 6 at 133,531,231 bp
  • T to G, chromosome 6 at 139,496,526 bp
  • A to T, chromosome 7 at 4,919,940 bp
  • T to C, chromosome 7 at 6,711,428 bp
  • A to G, chromosome 7 at 19,588,603 bp
  • C to T, chromosome 7 at 98,132,882 bp
  • T to A, chromosome 7 at 103,670,489 bp
  • T to A, chromosome 7 at 107,074,758 bp
  • C to A, chromosome 7 at 121,941,169 bp
  • T to G, chromosome 7 at 126,396,579 bp
  • T to C, chromosome 7 at 130,537,002 bp
  • T to A, chromosome 7 at 135,143,778 bp
  • T to C, chromosome 7 at 141,441,380 bp
  • T to G, chromosome 8 at 25,910,888 bp
  • T to G, chromosome 8 at 64,098,471 bp
  • A to T, chromosome 8 at 69,793,849 bp
  • A to T, chromosome 8 at 71,479,258 bp
  • T to A, chromosome 8 at 93,525,658 bp
  • A to T, chromosome 8 at 105,312,793 bp
  • C to A, chromosome 8 at 124,557,100 bp
  • G to A, chromosome 9 at 19,808,860 bp
  • A to C, chromosome 9 at 38,349,203 bp
  • G to T, chromosome 9 at 44,454,121 bp
  • T to A, chromosome 9 at 59,894,352 bp
  • A to T, chromosome 10 at 9,534,803 bp
  • A to T, chromosome 10 at 19,759,640 bp
  • A to T, chromosome 10 at 61,862,746 bp
  • A to G, chromosome 10 at 89,576,330 bp
  • A to T, chromosome 10 at 128,682,817 bp
  • T to A, chromosome 11 at 3,685,963 bp
  • G to A, chromosome 11 at 6,590,886 bp
  • T to A, chromosome 11 at 46,360,288 bp
  • C to T, chromosome 11 at 49,552,464 bp
  • T to A, chromosome 11 at 58,968,494 bp
  • T to C, chromosome 11 at 60,857,710 bp
  • A to G, chromosome 11 at 72,404,013 bp
  • A to T, chromosome 11 at 74,441,766 bp
  • G to A, chromosome 11 at 75,166,887 bp
  • A to T, chromosome 11 at 98,654,901 bp
  • A to G, chromosome 12 at 84,405,393 bp
  • G to A, chromosome 12 at 86,722,907 bp
  • A to G, chromosome 12 at 99,209,506 bp
  • C to T, chromosome 13 at 55,014,426 bp
  • A to T, chromosome 13 at 55,320,925 bp
  • G to A, chromosome 13 at 64,365,218 bp
  • C to A, chromosome 13 at 95,443,895 bp
  • A to T, chromosome 13 at 112,624,779 bp
  • C to T, chromosome 14 at 16,290,774 bp
  • A to T, chromosome 14 at 63,819,422 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • T to C, chromosome 15 at 31,367,286 bp
  • T to G, chromosome 15 at 31,605,957 bp
  • T to G, chromosome 15 at 81,427,492 bp
  • G to A, chromosome 15 at 97,806,499 bp
  • C to T, chromosome 15 at 99,698,819 bp
  • T to A, chromosome 16 at 13,986,812 bp
  • T to C, chromosome 16 at 18,624,897 bp
  • G to A, chromosome 16 at 23,060,482 bp
  • A to T, chromosome 17 at 19,521,916 bp
  • A to G, chromosome 17 at 24,595,219 bp
  • A to T, chromosome 17 at 47,348,642 bp
  • A to G, chromosome 17 at 55,991,245 bp
  • A to T, chromosome 17 at 56,171,727 bp
  • T to A, chromosome 17 at 56,885,169 bp
  • A to T, chromosome 17 at 74,856,549 bp
  • G to A, chromosome 18 at 7,222,676 bp
  • T to A, chromosome 18 at 20,527,815 bp
  • C to A, chromosome 19 at 11,258,679 bp
  • G to T, chromosome 19 at 16,872,456 bp
  • A to T, chromosome Y at 1,307,880 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0521 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038714-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.