Strain Name:
C57BL/6J-MtgxR0550Btlr/Mmmh
Stock Number:
038742-MU
Citation ID:
RRID:MMRRC_038742-MU
Other Names:
R0550 (G1), C57BL/6J-MtgxR0550Btlr
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 80297
Homologene: 11879
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14411
Homologene: 128225
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 271639
Homologene: 10188
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230793
Homologene: 17144
Cwc27
Name: CWC27 spliceosome-associated protein
Synonyms: NY-CO-10, 3110009E13Rik, Sdccag10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67285
Homologene: 21192
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70508
Homologene: 10634
Epb41
Name: erythrocyte membrane protein band 4.1
Synonyms: 4.1R, Elp-1, Elp1, D4Ertd442e, Epb4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269587
HGNC: HGNC:3377
Homologene: 44324
Eif3l
Name: eukaryotic translation initiation factor 3, subunit L
Synonyms: PAF67, 0610011H21Rik, HSP-66Y, Eif3s6ip, Eif3eip, D15N1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223691
VEGA: 15
Homologene: 9380
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Usp10
Name: ubiquitin specific peptidase 10
Synonyms: Uchrp, 2610014N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 22224
Homologene: 31294
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219249
Homologene: 12771
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50781
HGNC: HGNC:2893
Homologene: 8303
Atp6v1c1
Name: ATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms: 1700025B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66335
VEGA: 15
HGNC: HGNC:856
Homologene: 1281
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Aqr
Name: aquarius
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11834
Homologene: 7629
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Ddx18
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Aldh16a1
Name: aldehyde dehydrogenase 16 family, member A1
Synonyms: 2410004H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69748
Homologene: 34938
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: nectin-3, 4921513D19Rik, 2610301B19Rik, 3000002N23Rik, Pvrl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 58998
Homologene: 9162
Plpp1
Name: phospholipid phosphatase 1
Synonyms: mPAP, Lipid phosphate phosphatase 1, LPP1, LPP-1, Hpic53, Ppap2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19012
VEGA: 13
HGNC: HGNC:9228
Homologene: 134049
Casz1
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, D4Ertd432e, castor, Cst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69743
Homologene: 9824
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Il6st
Name: interleukin 6 signal transducer
Synonyms: gp130, CD130, D13Ertd699e, 5133400A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16195
HGNC: HGNC:6021
Homologene: 1645
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20787
Homologene: 3079
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 238988
Homologene: 69188
Polr3g
Name: polymerase (RNA) III (DNA directed) polypeptide G
Synonyms: RPC32, 2310047G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67486
Homologene: 38184
Cd2bp2
Name: CD2 cytoplasmic tail binding protein 2
Synonyms: 2410024K20Rik, 1500011B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70233
HGNC: HGNC:1656
Homologene: 4455
Usp6nl
Name: USP6 N-terminal like
Synonyms: TRE2NL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98910
Homologene: 6879
Slc25a38
Name: solute carrier family 25, member 38
Synonyms: appoptosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208638
Homologene: 5553
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
St6galnac4
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Synonyms: ST6GalNAc IV, Siat7d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20448
Homologene: 7939
Krt74
Name: keratin 74
Synonyms: Kb37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 406222
VEGA: 15
Pced1a
Name: PC-esterase domain containing 1A
Synonyms: A930025D01Rik, Fam113a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319513
Homologene: 11241
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Bmper
Name: BMP-binding endothelial regulator
Synonyms: Cv2, 3110056H04Rik, CV-2, Crim3, crossveinless-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73230
VEGA: 9
Homologene: 12494
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Setd1b
Name: SET domain containing 1B
Synonyms: KMT2G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208043
Homologene: 134654
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 380660
Homologene: 11587
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242418
Homologene: 32581
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 236537
Homologene: 45160
Fshr
Name: follicle stimulating hormone receptor
Synonyms: follicle-stimulating hormone receptor, Follitropin receptor, FSH-R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14309
VEGA: 17
HGNC: HGNC:3969
Homologene: 117
Ankrd36
Name: ankyrin repeat domain 36
Synonyms: 1700012M14Rik, GC3, 1700008J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76389
Homologene: 137366
F830045P16Rik
Name: RIKEN cDNA F830045P16 gene
Synonyms: Sirpb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228592
Homologene: 136180
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 170756
Homologene: 41602
Slc25a48
Name: solute carrier family 25, member 48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328258
Homologene: 27065
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Or8b46
Name: olfactory receptor family 8 subfamily B member 46
Synonyms: GA_x6K02T2PVTD-32239063-32239995, MOR165-3, Olfr910
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258807
VEGA: 9
Homologene: 115510
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Cnih3
Name: cornichon family AMPA receptor auxiliary protein 3
Synonyms: 2900075G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 72978
Homologene: 12486
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30785
Homologene: 14125
Whamm
Name: WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms: Whdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434204
Homologene: 45851
Or8k27
Name: olfactory receptor family 8 subfamily K member 27
Synonyms: GA_x6K02T2Q125-47915274-47914333, MOR190-1, Olfr1065
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258403
Homologene: 74195
Sh3tc1
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231147
Homologene: 10360
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Or5b97
Name: olfactory receptor family 5 subfamily B member 97
Synonyms: GA_x6K02T2RE5P-3231251-3230331, MOR202-3, Olfr1447
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258698
HGNC: HGNC:8324
Homologene: 74233
Sfxn4
Name: sideroflexin 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 94281
Homologene: 14228
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227394
Homologene: 62654
Or4c12
Name: olfactory receptor family 4 subfamily C member 12
Synonyms: GA_x6K02T2Q125-51376062-51375133, MOR232-9, Olfr1259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258338
Homologene: 128115
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: 4933402B14Rik, Gm6095, 4921529N20Rik, Tmem146
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Or5aq6
Name: olfactory receptor family 5 subfamily AQ member 6
Synonyms: GA_x6K02T2Q125-48586461-48585523, MOR172-5, Olfr1109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258762
Homologene: 86672
Atp8b2
Name: ATPase, class I, type 8B, member 2
Synonyms: Id
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54667
Homologene: 23226
Gbp11
Name: guanylate binding protein 11
Synonyms: Gm7141
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 634650
Homologene: 128731
Dr1
Name: down-regulator of transcription 1
Synonyms: NC2, Dr1l, 1700121L09Rik, NC2beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13486
HGNC: HGNC:3017
Homologene: 38809
Opn1sw
Name: opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Synonyms: Blue/UV Opsin, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin, Bcp, UV cone pigment
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12057
HGNC: HGNC:1012
Homologene: 1291
Or52m1
Name: olfactory receptor family 52 subfamily M member 1
Synonyms: GA_x6K02T2PBJ9-5356887-5357840, MOR25-1, Olfr554
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258322
Homologene: 105158
Clrn3
Name: clarin 3
Synonyms: Tmem12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 212070
Homologene: 17544
Gm2a
Name: GM2 ganglioside activator protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14667
HGNC: HGNC:4367
Homologene: 349
Ccdc92b
Name: coiled-coil domain containing 92B
Synonyms: E130309D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432582
Homologene: 134144
Fads6
Name: fatty acid desaturase domain family, member 6
Synonyms: OTTMUSG00000021749, BC050213
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 328035
Homologene: 18646
Mylk4
Name: myosin light chain kinase family, member 4
Synonyms: EG238564
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238564
Homologene: 66243
Srl
Name: sarcalumenin
Synonyms: sarcalumenin, sar, 9830004M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106393
Homologene: 45500
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 259001
Homologene: 74112
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 26456
Homologene: 22682
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,347,223 bp
  • A to C, chromosome 1 at 96,867,859 bp
  • T to C, chromosome 1 at 121,555,375 bp
  • A to G, chromosome 1 at 165,565,315 bp
  • TTGACGAG to T, chromosome 1 at 181,406,477 bp
  • A to G, chromosome 2 at 6,400,323 bp
  • T to A, chromosome 2 at 32,594,019 bp
  • A to G, chromosome 2 at 49,758,912 bp
  • A to G, chromosome 2 at 60,425,350 bp
  • A to T, chromosome 2 at 86,445,876 bp
  • G to T, chromosome 2 at 87,093,129 bp
  • A to G, chromosome 2 at 89,943,389 bp
  • A to C, chromosome 2 at 114,132,976 bp
  • T to C, chromosome 2 at 129,463,509 bp
  • G to A, chromosome 2 at 130,419,633 bp
  • A to G, chromosome 3 at 5,400,494 bp
  • C to T, chromosome 3 at 89,959,061 bp
  • A to G, chromosome 4 at 32,730,479 bp
  • C to T, chromosome 4 at 41,596,274 bp
  • T to C, chromosome 4 at 45,372,753 bp
  • A to T, chromosome 4 at 90,224,690 bp
  • T to C, chromosome 4 at 117,096,433 bp
  • A to G, chromosome 4 at 131,975,613 bp
  • G to A, chromosome 4 at 133,063,037 bp
  • GCCACCACCACCACCACCACCAC to GCCACCACCACCACCACCAC, chromosome 4 at 148,952,284 bp
  • T to C, chromosome 5 at 35,699,784 bp
  • A to T, chromosome 5 at 105,343,750 bp
  • G to A, chromosome 5 at 108,269,605 bp
  • A to G, chromosome 5 at 120,531,155 bp
  • G to T, chromosome 5 at 123,157,660 bp
  • T to G, chromosome 6 at 18,435,309 bp
  • A to T, chromosome 6 at 29,380,204 bp
  • G to A, chromosome 6 at 121,356,918 bp
  • T to C, chromosome 7 at 27,364,378 bp
  • C to T, chromosome 7 at 45,146,229 bp
  • G to A, chromosome 7 at 81,586,224 bp
  • G to A, chromosome 7 at 102,640,950 bp
  • A to G, chromosome 7 at 112,158,245 bp
  • G to T, chromosome 7 at 127,193,824 bp
  • T to A, chromosome 7 at 135,528,425 bp
  • T to A, chromosome 8 at 81,997,337 bp
  • A to G, chromosome 8 at 110,587,775 bp
  • T to A, chromosome 8 at 119,947,801 bp
  • A to T, chromosome 9 at 7,120,954 bp
  • T to A, chromosome 9 at 23,373,885 bp
  • T to A, chromosome 9 at 38,539,380 bp
  • C to T, chromosome 9 at 110,642,158 bp
  • A to T, chromosome 9 at 120,123,643 bp
  • C to A, chromosome 10 at 107,053,471 bp
  • T to C, chromosome 11 at 5,607,429 bp
  • C to T, chromosome 11 at 55,103,665 bp
  • G to A, chromosome 11 at 60,201,676 bp
  • T to A, chromosome 11 at 74,629,945 bp
  • A to T, chromosome 11 at 110,293,840 bp
  • A to G, chromosome 11 at 115,296,677 bp
  • A to T, chromosome 12 at 81,725,781 bp
  • T to C, chromosome 13 at 32,716,666 bp
  • A to G, chromosome 13 at 56,448,998 bp
  • T to C, chromosome 13 at 64,762,000 bp
  • A to T, chromosome 13 at 68,982,361 bp
  • G to A, chromosome 13 at 81,694,773 bp
  • G to A, chromosome 13 at 104,804,949 bp
  • G to A, chromosome 13 at 112,475,114 bp
  • T to C, chromosome 13 at 112,834,985 bp
  • A to G, chromosome 14 at 28,271,651 bp
  • C to A, chromosome 14 at 87,486,220 bp
  • T to C, chromosome 15 at 38,682,929 bp
  • A to G, chromosome 15 at 79,076,867 bp
  • G to A, chromosome 15 at 101,760,679 bp
  • A to G, chromosome 16 at 4,487,565 bp
  • A to G, chromosome 16 at 5,062,620 bp
  • A to G, chromosome 16 at 46,458,820 bp
  • T to C, chromosome 16 at 50,274,533 bp
  • A to G, chromosome 16 at 58,926,385 bp
  • C to T, chromosome 17 at 43,038,213 bp
  • T to C, chromosome 17 at 56,663,427 bp
  • T to A, chromosome 17 at 78,624,793 bp
  • T to C, chromosome 17 at 89,045,125 bp
  • A to T, chromosome 19 at 12,901,800 bp
  • A to G, chromosome 19 at 22,987,812 bp
  • A to T, chromosome 19 at 44,997,665 bp
  • A to G, chromosome 19 at 60,850,945 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0550 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038742-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.