Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0550Btlr/Mmmh
Stock Number:
038742-MU
Citation ID:
RRID:MMRRC_038742-MU
Other Names:
R0550 (G1), C57BL/6J-MtgxR0550Btlr
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Cwc27
Name: CWC27 spliceosome-associated protein
Synonyms: NY-CO-10, 3110009E13Rik, Sdccag10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67285
Homologene: 21192
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,347,223 bp
  • A to C, chromosome 1 at 96,867,859 bp
  • T to C, chromosome 1 at 121,555,375 bp
  • A to G, chromosome 1 at 165,565,315 bp
  • TTGACGAG to T, chromosome 1 at 181,406,477 bp
  • A to G, chromosome 2 at 6,400,323 bp
  • T to A, chromosome 2 at 32,594,019 bp
  • A to G, chromosome 2 at 49,758,912 bp
  • A to G, chromosome 2 at 60,425,350 bp
  • A to T, chromosome 2 at 86,445,876 bp
  • G to T, chromosome 2 at 87,093,129 bp
  • A to G, chromosome 2 at 89,943,389 bp
  • A to C, chromosome 2 at 114,132,976 bp
  • T to C, chromosome 2 at 129,463,509 bp
  • G to A, chromosome 2 at 130,419,633 bp
  • A to G, chromosome 3 at 5,400,494 bp
  • C to T, chromosome 3 at 89,959,061 bp
  • A to G, chromosome 4 at 32,730,479 bp
  • C to T, chromosome 4 at 41,596,274 bp
  • T to C, chromosome 4 at 45,372,753 bp
  • A to T, chromosome 4 at 90,224,690 bp
  • T to C, chromosome 4 at 117,096,433 bp
  • A to G, chromosome 4 at 131,975,613 bp
  • G to A, chromosome 4 at 133,063,037 bp
  • GCCACCACCACCACCACCACCAC to GCCACCACCACCACCACCAC, chromosome 4 at 148,952,284 bp
  • T to C, chromosome 5 at 35,699,784 bp
  • A to T, chromosome 5 at 105,343,750 bp
  • G to A, chromosome 5 at 108,269,605 bp
  • A to G, chromosome 5 at 120,531,155 bp
  • G to T, chromosome 5 at 123,157,660 bp
  • T to G, chromosome 6 at 18,435,309 bp
  • A to T, chromosome 6 at 29,380,204 bp
  • G to A, chromosome 6 at 121,356,918 bp
  • T to C, chromosome 7 at 27,364,378 bp
  • C to T, chromosome 7 at 45,146,229 bp
  • G to A, chromosome 7 at 81,586,224 bp
  • G to A, chromosome 7 at 102,640,950 bp
  • A to G, chromosome 7 at 112,158,245 bp
  • G to T, chromosome 7 at 127,193,824 bp
  • T to A, chromosome 7 at 135,528,425 bp
  • T to A, chromosome 8 at 81,997,337 bp
  • A to G, chromosome 8 at 110,587,775 bp
  • T to A, chromosome 8 at 119,947,801 bp
  • A to T, chromosome 9 at 7,120,954 bp
  • T to A, chromosome 9 at 23,373,885 bp
  • T to A, chromosome 9 at 38,539,380 bp
  • C to T, chromosome 9 at 110,642,158 bp
  • A to T, chromosome 9 at 120,123,643 bp
  • C to A, chromosome 10 at 107,053,471 bp
  • T to C, chromosome 11 at 5,607,429 bp
  • C to T, chromosome 11 at 55,103,665 bp
  • G to A, chromosome 11 at 60,201,676 bp
  • T to A, chromosome 11 at 74,629,945 bp
  • A to T, chromosome 11 at 110,293,840 bp
  • A to G, chromosome 11 at 115,296,677 bp
  • A to T, chromosome 12 at 81,725,781 bp
  • T to C, chromosome 13 at 32,716,666 bp
  • A to G, chromosome 13 at 56,448,998 bp
  • T to C, chromosome 13 at 64,762,000 bp
  • A to T, chromosome 13 at 68,982,361 bp
  • G to A, chromosome 13 at 81,694,773 bp
  • G to A, chromosome 13 at 104,804,949 bp
  • G to A, chromosome 13 at 112,475,114 bp
  • T to C, chromosome 13 at 112,834,985 bp
  • A to G, chromosome 14 at 28,271,651 bp
  • C to A, chromosome 14 at 87,486,220 bp
  • T to C, chromosome 15 at 38,682,929 bp
  • A to G, chromosome 15 at 79,076,867 bp
  • G to A, chromosome 15 at 101,760,679 bp
  • A to G, chromosome 16 at 4,487,565 bp
  • A to G, chromosome 16 at 5,062,620 bp
  • A to G, chromosome 16 at 46,458,820 bp
  • T to C, chromosome 16 at 50,274,533 bp
  • A to G, chromosome 16 at 58,926,385 bp
  • C to T, chromosome 17 at 43,038,213 bp
  • T to C, chromosome 17 at 56,663,427 bp
  • T to A, chromosome 17 at 78,624,793 bp
  • T to C, chromosome 17 at 89,045,125 bp
  • A to T, chromosome 19 at 12,901,800 bp
  • A to G, chromosome 19 at 22,987,812 bp
  • A to T, chromosome 19 at 44,997,665 bp
  • A to G, chromosome 19 at 60,850,945 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0550 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038742-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.