Strain Name:
C57BL/6J-MtgxR0592Btlr/Mmmh
Stock Number:
038782-MU
Citation ID:
RRID:MMRRC_038782-MU
Other Names:
R0592 (G1), C57BL/6J-MtgxR0592Btlr
Major Collection:

Strain Information

Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 2500002E12Rik, 1100001C18Rik, A330076K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: NuMA, 6720401E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Jhdm1b, Cxxc2, Fbxl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Gstz1
Name: glutathione transferase zeta 1 (maleylacetoacetate isomerase)
Synonyms: maleylacetoacetate isomerase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14874
VEGA: 12
HGNC: HGNC:4643
Homologene: 7747
Riox2
Name: ribosomal oxygenase 2
Synonyms: Mina, 3830408E23Rik, 1810047J07Rik, 2410057H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67014
Homologene: 12071
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: bHLHb32, Hrt2, Hesr2, Herp1, CHF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Rab37
Name: RAB37, member RAS oncogene family
Synonyms: B230331O03Rik, B230354I04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58222
Homologene: 23303
Strip2
Name: striatin interacting protein 2
Synonyms: Myoscape, Fam40b, D330017J20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Vezf1
Name: vascular endothelial zinc finger 1
Synonyms: db1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22344
Homologene: 5175
Exosc10
Name: exosome component 10
Synonyms: p4, PM-Scl, RRP6, p2, PM/Scl-100, p3, Pmscl2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Katnal2
Name: katanin p60 subunit A-like 2
Synonyms: 4933439B08Rik, 3110023G01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71206
Homologene: 41725
Mov10l1
Name: Mov10 like RISC complex RNA helicase 1
Synonyms: CHAMP, Csm
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83456
HGNC: HGNC:7201
Homologene: 56835
Slc25a47
Name: solute carrier family 25, member 47
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104910
VEGA: 12
Homologene: 64441
Bbs7
Name: Bardet-Biedl syndrome 7
Synonyms: 8430406N16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71492
Homologene: 12395
Elmod1
Name: ELMO/CED-12 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270162
VEGA: 9
Homologene: 10280
Cdh5
Name: cadherin 5
Synonyms: VEC, VE-Cad, CD144, 7B4/cadherin-5, VEcad, VECD, VE-cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: V2Rp5, EG619697
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Serpinb6e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonyms: ovalbumin, SPI3B, Gm11396
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 435350
HGNC: HGNC:8950
Homologene: 50933
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: Oasl10, 2'-5' oligoadenylate synthetase-like 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Tex10
Name: testis expressed gene 10
Synonyms: 2810462N03Rik, clone 18330, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Tcaf3
Name: TRPM8 channel-associated factor 3
Synonyms: Fam115e, Eapa2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 403088
Homologene: 74374
Slc9b1
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms: 1700094G20Rik, 4933425K02Rik, 4933424B12Rik, Nhedc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74446
Homologene: 49914
Iqce
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Or2d2
Name: olfactory receptor family 2 subfamily D member 2
Synonyms: MOR260-1, Olfr715, GA_x6K02T2PBJ9-9479517-9478573
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258776
HGNC: HGNC:8244
Homologene: 81541
Bglap
Name: bone gamma carboxyglutamate protein
Synonyms: OC, mOC-A, Bglap1, OG1, bone Gla protein, osteocalcin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12096
HGNC: HGNC:1043
Homologene: 104130
Fhl3
Name: four and a half LIM domains 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14201
HGNC: HGNC:3704
Homologene: 37928
C2cd4b
Name: C2 calcium-dependent domain containing 4B
Synonyms: Fam148b, 3300001A09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75697
Homologene: 78036
Trmu
Name: tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms: 1600025P05Rik, Trmt1, Mtu1, 1110005N20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72026
Homologene: 5589
Or5b117
Name: olfactory receptor family 5 subfamily B member 117
Synonyms: Olfr1472, MOR202-16, GA_x6K02T2RE5P-3787124-3786180
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258685
Homologene: 77370
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,456,612 bp
  • A to G, chromosome 2 at 112,678,481 bp
  • A to T, chromosome 3 at 36,610,297 bp
  • T to A, chromosome 3 at 88,383,655 bp
  • A to T, chromosome 3 at 135,394,074 bp
  • C to T, chromosome 4 at 48,456,800 bp
  • C to A, chromosome 4 at 63,415,567 bp
  • A to G, chromosome 4 at 124,705,677 bp
  • T to C, chromosome 4 at 148,581,113 bp
  • A to G, chromosome 5 at 120,771,149 bp
  • G to A, chromosome 5 at 122,961,134 bp
  • A to T, chromosome 5 at 140,686,107 bp
  • T to A, chromosome 6 at 29,931,210 bp
  • T to C, chromosome 6 at 42,596,843 bp
  • A to G, chromosome 7 at 102,013,897 bp
  • G to A, chromosome 7 at 107,129,343 bp
  • T to A, chromosome 8 at 99,279,478 bp
  • T to A, chromosome 8 at 104,130,902 bp
  • A to G, chromosome 9 at 53,926,106 bp
  • G to A, chromosome 9 at 67,760,691 bp
  • T to A, chromosome 10 at 8,729,782 bp
  • C to A, chromosome 10 at 30,833,957 bp
  • A to T, chromosome 11 at 88,068,435 bp
  • T to A, chromosome 11 at 88,068,436 bp
  • T to G, chromosome 11 at 115,160,523 bp
  • G to A, chromosome 12 at 87,163,721 bp
  • G to A, chromosome 12 at 108,854,258 bp
  • T to A, chromosome 13 at 33,841,074 bp
  • T to C, chromosome 14 at 118,902,139 bp
  • T to C, chromosome 15 at 85,896,826 bp
  • A to G, chromosome 15 at 88,998,766 bp
  • A to G, chromosome 16 at 17,107,219 bp
  • T to C, chromosome 16 at 59,489,579 bp
  • C to T, chromosome 17 at 23,386,915 bp
  • A to T, chromosome 18 at 77,002,560 bp
  • GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC to GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC, chromosome 19 at 6,245,007 bp
  • T to C, chromosome 19 at 13,453,705 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0592 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038782-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.