Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0680Btlr/Mmmh
Stock Number:
038865-MU
Citation ID:
RRID:MMRRC_038865-MU
Other Names:
R0680 (G1), C57BL/6J-MtgxR0680Btlr
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Sugt1
Name: SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Synonyms: SGT1, 2410174K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67955
VEGA: 14
Homologene: 4877
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Slc6a3
Name: solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Synonyms: DAT, Dat1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13162
VEGA: 13
Homologene: 55547
Pirb
Name: paired Ig-like receptor B
Synonyms: Gp91, Lilrb3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18733
Homologene: 134028
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Zfp148
Name: zinc finger protein 148
Synonyms: beta enolase repressor factor 1, BERF-1, BFCOL1, 2210405J08Rik, ZBP-89
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22661
VEGA: 16
Homologene: 8003
Ccdc174
Name: coiled-coil domain containing 174
Synonyms: C130022K22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232236
Homologene: 9523
Dennd2a
Name: DENN domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209773
Homologene: 35238
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: Gpig4, 4732452O09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320292
Homologene: 14860
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, Catnd2, neurojugin, catenin (cadherin associated protein), delta 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Gm426, AI481877, Mzip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100155
Homologene: 79783
Rnf139
Name: ring finger protein 139
Synonyms: 4930555P18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75841
VEGA: 15
Homologene: 5222
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Ulbp3
Name: UL16 binding protein 3
Synonyms: 9230019H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215728
VEGA: 10
Or52n2
Name: olfactory receptor family 52 subfamily N member 2
Synonyms: GA_x6K02T2PBJ9-7522449-7521493, MOR34-1, Olfr666
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259100
Homologene: 64956
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Or6c69b
Name: olfactory receptor family 6 subfamily C member 69B
Synonyms: GA_x6K02T2PULF-11470271-11469333, MOR113-4, Olfr810
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258543
Homologene: 46347
Ugt1a2
Name: UDP glucuronosyltransferase 1 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22236
Homologene: 86211
Or4c11c
Name: olfactory receptor family 4 subfamily C member 11C
Synonyms: GA_x6K02T2Q125-50336588-50337313, GA_x6K02T2Q125-50304328-50305251, MOR230-3, MOR230-1, Olfr1203, Olfr1205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258898
Homologene: 81567
Shisa7
Name: shisa family member 7
Synonyms: D430041B17Rik, CKAMP59
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232813
Homologene: 122129
Or14a257
Name: olfactory receptor family 14 subfamily A member 257
Synonyms: GA_x6K02T2NHDJ-9619796-9620794, MOR219-4, Olfr298
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257905
Stx1b
Name: syntaxin 1B
Synonyms: Stx1b2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56216
Homologene: 69375
Il9
Name: interleukin 9
Synonyms: Il-9, P40
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16198
VEGA: 13
HGNC: HGNC:6029
Homologene: 492
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 88,201,211 bp
  • T to C, chromosome 1 at 90,778,981 bp
  • A to C, chromosome 2 at 37,399,835 bp
  • T to A, chromosome 2 at 82,991,359 bp
  • A to T, chromosome 2 at 88,831,780 bp
  • T to A, chromosome 2 at 120,527,016 bp
  • C to A, chromosome 2 at 121,251,868 bp
  • A to T, chromosome 3 at 144,969,367 bp
  • T to C, chromosome 4 at 59,043,967 bp
  • TACACACACACACACACACACACACACACAC to TACACACACACACACACACACACACACACACAC, chromosome 5 at 99,232,050 bp
  • T to C, chromosome 6 at 17,942,733 bp
  • A to T, chromosome 6 at 39,483,062 bp
  • C to T, chromosome 6 at 91,895,355 bp
  • T to A, chromosome 7 at 3,717,361 bp
  • T to A, chromosome 7 at 4,831,723 bp
  • T to C, chromosome 7 at 6,962,885 bp
  • A to C, chromosome 7 at 13,260,321 bp
  • A to T, chromosome 7 at 86,489,337 bp
  • A to G, chromosome 7 at 104,893,004 bp
  • A to G, chromosome 7 at 127,807,723 bp
  • T to A, chromosome 8 at 105,355,907 bp
  • T to A, chromosome 9 at 44,948,060 bp
  • T to A, chromosome 10 at 3,125,133 bp
  • A to G, chromosome 10 at 127,589,661 bp
  • T to A, chromosome 10 at 129,790,818 bp
  • A to T, chromosome 11 at 98,180,166 bp
  • A to G, chromosome 11 at 120,822,234 bp
  • T to A, chromosome 12 at 11,241,869 bp
  • G to A, chromosome 13 at 13,650,341 bp
  • T to C, chromosome 13 at 56,481,880 bp
  • G to A, chromosome 13 at 59,800,599 bp
  • T to C, chromosome 13 at 73,538,727 bp
  • A to T, chromosome 13 at 89,679,822 bp
  • A to G, chromosome 14 at 79,610,311 bp
  • T to A, chromosome 15 at 30,972,891 bp
  • T to C, chromosome 15 at 58,899,652 bp
  • A to G, chromosome 16 at 33,495,804 bp
  • G to C, chromosome 18 at 37,490,294 bp
  • G to A, chromosome 19 at 3,947,093 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0680 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.