Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0727Btlr/Mmmh
Stock Number:
038909-MU
Citation ID:
RRID:MMRRC_038909-MU
Other Names:
R0727 (G1), C57BL/6J-MtgxR0727Btlr
Major Collection:

Strain Information

Hyal1
Name: hyaluronoglucosaminidase 1
Synonyms: Hyal-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15586
HGNC: HGNC:5320
Homologene: 5277
Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Faah
Name: fatty acid amide hydrolase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14073
HGNC: HGNC:3553
Homologene: 68184
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Csde1
Name: cold shock domain containing E1, RNA binding
Synonyms: unr, D3Jfr1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229663
Homologene: 5179
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: DNA Topoisomerase II alpha, Top-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21973
Homologene: 830
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Pum2
Name: pumilio RNA-binding family member 2
Synonyms: Pumm2, 5730503J23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 80913
Homologene: 69183
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 12H19.01.T7, 6330404C01Rik, 9930013L23Rik, Hybid
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Grhl3
Name: grainyhead like transcription factor 3
Synonyms: Som, Get1, ct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230824
Homologene: 18864
Rab6a
Name: RAB6A, member RAS oncogene family
Synonyms: 2610028L11Rik, Rab6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19346
HGNC: HGNC:9786
Homologene: 55697
R3hcc1l
Name: R3H domain and coiled-coil containing 1 like
Synonyms: 1700036B12Rik, D19Ertd386e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52013
Homologene: 8707
Farsa
Name: phenylalanyl-tRNA synthetase, alpha subunit
Synonyms: 0610012A19Rik, Farsla
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66590
HGNC: HGNC:3592
Homologene: 3280
Obi1
Name: ORC ubiquitin ligase 1
Synonyms: 2810449K13Rik, 2610206B13Rik, Rnf219
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72486
VEGA: 14
Homologene: 11578
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Sucnr1
Name: succinate receptor 1
Synonyms: Gpr91
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84112
HGNC: HGNC:4542
Homologene: 41865
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68428
Homologene: 10084
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: SRC-a/NCoA-1, SRC-1, SRC1, steroid receptor coactivator-1, KAT13A, bHLHe74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
H2bl1
Name: H2B.L histone variant 1
Synonyms: SubH2Bv, 1700024P04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69382
Homologene: 105972
Fgfr4
Name: fibroblast growth factor receptor 4
Synonyms: Fgfr-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14186
HGNC: HGNC:3691
Homologene: 20461
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Stk33
Name: serine/threonine kinase 33
Synonyms: 4921505G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117229
Homologene: 75307
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Micall1
Name: microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Synonyms: Mus EST 820961, D15N2e, D15Mit260
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27008
VEGA: 15
Homologene: 24911
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: Ph30-beta, Ftnb, fertilin beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Zcwpw1
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381678
Homologene: 9944
Adamts1
Name: ADAM metallopeptidase with thrombospondin type 1 motif 1
Synonyms: ADAM-TS1, METH1, METH-1, ADAMTS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Pbld1
Name: phenazine biosynthesis-like protein domain containing 1
Synonyms: 0610038K03Rik, Pbld
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68371
VEGA: 10
Homologene: 41470
AC149051.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Gucy1b2
Name: guanylate cyclase 1, soluble, beta 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239134
HGNC: HGNC:4686
Homologene: 136630
Pabpc2
Name: poly(A) binding protein, cytoplasmic 2
Synonyms: Pabp2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18459
Homologene: 56509
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, Snep, D430044C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208777
Homologene: 14708
Or8k27
Name: olfactory receptor family 8 subfamily K member 27
Synonyms: GA_x6K02T2Q125-47915274-47914333, MOR190-1, Olfr1065
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258403
Homologene: 74195
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-7P, MOR40-15, Olfr504
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258163
Homologene: 17189
Rfpl4
Name: ret finger protein-like 4
Synonyms: D7Ertd486e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 192658
Homologene: 90101
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218441
Homologene: 8826
Hoxa9
Name: homeobox A9
Synonyms: D6a9, Hox-1.7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15405
HGNC: HGNC:5109
Homologene: 7766
Ergic2
Name: ERGIC and golgi 2
Synonyms: 4930572C01Rik, 1200009B18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67456
Homologene: 6574
Ssh3
Name: slingshot protein phosphatase 3
Synonyms: SSH-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 245857
VEGA: 19
Homologene: 32372
Zfp874b
Name: zinc finger protein 874b
Synonyms: 9630025I21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408067
Homologene: 135597
Actr3b
Name: ARP3 actin-related protein 3B
Synonyms: ARP11, Arp3b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242894
Homologene: 4180
Or11h6
Name: olfactory receptor family 11 subfamily H member 6
Synonyms: GA_x6K02T2PMLR-6361495-6362481, MOR106-11, Olfr745
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258296
Homologene: 27116
Rassf5
Name: Ras association (RalGDS/AF-6) domain family member 5
Synonyms: 1300019G20Rik, Nore1B, Nore1A, Rapl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54354
Homologene: 10296
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: GA_x6K02T2Q125-48079993-48079157, MOR192-4_p, Olfr1082
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Or5w22
Name: olfactory receptor family 5 subfamily W member 22
Synonyms: V5, Olfr4-2, GA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr153
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110511
Homologene: 128127
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Gm17093
Name: predicted gene 17093
Type: Gene
Species: Mouse
Chromosome: 14
Homologene: 128452
Ftdc2
Name: ferritin domain containing 2
Synonyms: Ftdc, E330017A01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224247
Homologene: 87248
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,084,558 bp
  • G to A, chromosome 1 at 93,281,654 bp
  • T to A, chromosome 1 at 120,227,817 bp
  • T to C, chromosome 1 at 131,181,265 bp
  • T to C, chromosome 2 at 40,750,944 bp
  • T to C, chromosome 2 at 86,445,938 bp
  • A to T, chromosome 2 at 86,594,380 bp
  • T to A, chromosome 2 at 87,532,901 bp
  • A to G, chromosome 2 at 104,777,311 bp
  • T to C, chromosome 2 at 144,568,785 bp
  • A to T, chromosome 3 at 5,401,073 bp
  • A to G, chromosome 3 at 60,086,660 bp
  • A to G, chromosome 3 at 103,043,638 bp
  • A to G, chromosome 4 at 116,005,060 bp
  • T to A, chromosome 4 at 135,546,254 bp
  • T to C, chromosome 5 at 25,811,939 bp
  • T to C, chromosome 5 at 137,810,807 bp
  • G to A, chromosome 5 at 144,828,456 bp
  • A to G, chromosome 6 at 52,224,314 bp
  • T to A, chromosome 6 at 148,199,400 bp
  • A to G, chromosome 6 at 149,325,822 bp
  • T to A, chromosome 7 at 5,115,293 bp
  • T to C, chromosome 7 at 68,212,158 bp
  • T to C, chromosome 7 at 83,961,578 bp
  • T to C, chromosome 7 at 100,636,682 bp
  • C to T, chromosome 7 at 108,565,108 bp
  • T to A, chromosome 7 at 109,321,518 bp
  • T to C, chromosome 7 at 118,166,422 bp
  • A to G, chromosome 8 at 36,572,674 bp
  • T to A, chromosome 8 at 61,130,136 bp
  • T to G, chromosome 8 at 63,927,782 bp
  • T to A, chromosome 8 at 84,861,304 bp
  • T to C, chromosome 8 at 84,921,415 bp
  • T to G, chromosome 8 at 85,091,526 bp
  • T to C, chromosome 8 at 123,126,286 bp
  • A to C, chromosome 9 at 15,996,699 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • G to A, chromosome 9 at 88,582,146 bp
  • T to C, chromosome 9 at 107,578,402 bp
  • T to A, chromosome 10 at 63,067,519 bp
  • A to G, chromosome 10 at 81,190,262 bp
  • T to A, chromosome 11 at 70,900,492 bp
  • A to T, chromosome 11 at 99,012,148 bp
  • G to A, chromosome 11 at 108,506,554 bp
  • T to C, chromosome 11 at 116,232,485 bp
  • A to G, chromosome 12 at 3,366,776 bp
  • A to G, chromosome 12 at 4,294,900 bp
  • A to G, chromosome 12 at 8,744,465 bp
  • G to T, chromosome 12 at 101,594,355 bp
  • C to T, chromosome 13 at 11,566,885 bp
  • C to A, chromosome 13 at 55,156,228 bp
  • T to C, chromosome 13 at 67,474,712 bp
  • T to C, chromosome 13 at 92,493,878 bp
  • A to G, chromosome 13 at 98,984,227 bp
  • A to G, chromosome 14 at 30,130,115 bp
  • A to G, chromosome 14 at 31,017,077 bp
  • T to C, chromosome 14 at 44,519,221 bp
  • T to C, chromosome 14 at 50,361,469 bp
  • G to T, chromosome 14 at 50,643,003 bp
  • A to G, chromosome 14 at 62,448,281 bp
  • A to G, chromosome 14 at 66,029,731 bp
  • G to C, chromosome 14 at 104,480,188 bp
  • A to G, chromosome 15 at 44,535,788 bp
  • A to G, chromosome 15 at 79,120,778 bp
  • A to G, chromosome 15 at 82,070,149 bp
  • G to A, chromosome 15 at 96,419,443 bp
  • A to G, chromosome 16 at 32,769,847 bp
  • T to C, chromosome 16 at 58,635,552 bp
  • T to C, chromosome 16 at 85,798,648 bp
  • A to C, chromosome 18 at 39,775,134 bp
  • G to T, chromosome 19 at 4,263,991 bp
  • T to C, chromosome 19 at 6,854,214 bp
  • T to C, chromosome 19 at 12,299,094 bp
  • A to G, chromosome 19 at 42,576,075 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0727 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038909-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.