Strain Name:
C57BL/6J-MtgxR1105Btlr/Mmmh
Stock Number:
039178-MU
Citation ID:
RRID:MMRRC_039178-MU
Other Names:
R1105 (G1), C57BL/6J-MtgxR1105Btlr
Major Collection:

Strain Information

Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Zik1
Name: zinc finger protein interacting with K protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22775
Homologene: 32076
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Ripk1
Name: receptor (TNFRSF)-interacting serine-threonine kinase 1
Synonyms: Rinp, Rip1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19766
Homologene: 2820
Bcl6
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12053
HGNC: HGNC:1001
Homologene: 7640
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Foxp2
Name: forkhead box P2
Synonyms: 2810043D05Rik, D0Kist7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Hsh2d
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209488
Homologene: 13142
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Gucy1b2
Name: guanylate cyclase 1, soluble, beta 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239134
HGNC: HGNC:4686
Homologene: 136630
Vmn1r90
Name: vomeronasal 1 receptor 90
Synonyms: B430211C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 627280
Homologene: 122945
Aif1
Name: allograft inflammatory factor 1
Synonyms: G1, Iba1, D17H6S50E
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11629
HGNC: HGNC:352
Homologene: 1226
Car7
Name: carbonic anhydrase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12354
HGNC: HGNC:1381
Homologene: 55875
Adm
Name: adrenomedullin
Synonyms: AM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11535
HGNC: HGNC:259
Homologene: 873
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Slpi
Name: secretory leukocyte peptidase inhibitor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20568
Homologene: 2305
Hs3st1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Synonyms: 3-OST, D5Wsu110e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15476
HGNC: HGNC:5194
Homologene: 3751
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
Homologene: 68141
Rpl18a
Name: ribosomal protein L18A
Synonyms: 2510019J09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76808
Homologene: 68104
Catsperz
Name: cation channel sperm associated auxiliary subunit zeta
Synonyms: A430107B04Rik, 1700019N12Rik, Tex40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67077
VEGA: 19
Homologene: 85555
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 2 at 122,337,702 bp
  • A to G, chromosome 2 at 164,354,867 bp
  • C to T, chromosome 4 at 108,542,448 bp
  • GGTACAGGCTGCGGTTGAGAGCCTTGTA to GGTA, chromosome 5 at 39,614,698 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • A to G, chromosome 6 at 15,416,047 bp
  • T to C, chromosome 6 at 81,939,453 bp
  • G to A, chromosome 7 at 10,490,385 bp
  • T to C, chromosome 7 at 14,578,812 bp
  • C to T, chromosome 7 at 44,139,513 bp
  • T to C, chromosome 7 at 110,628,849 bp
  • T to C, chromosome 7 at 135,701,050 bp
  • T to C, chromosome 8 at 70,896,014 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • T to C, chromosome 8 at 104,547,672 bp
  • T to C, chromosome 9 at 97,583,499 bp
  • A to G, chromosome 10 at 80,058,343 bp
  • T to C, chromosome 13 at 34,028,167 bp
  • A to T, chromosome 14 at 62,453,466 bp
  • T to A, chromosome 15 at 66,940,231 bp
  • G to T, chromosome 16 at 23,966,155 bp
  • G to A, chromosome 17 at 35,172,151 bp
  • A to T, chromosome 19 at 6,924,935 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1105 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039178-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.