MMRRC:039537-MU

T to A, chromosome 1 at 46,137,543 bp
T to C, chromosome 1 at 60,200,939 bp
T to A, chromosome 1 at 74,740,760 bp
T to C, chromosome 1 at 106,779,982 bp
A to C, chromosome 1 at 155,177,904 bp
G to A, chromosome 1 at 171,403,271 bp
G to T, chromosome 1 at 188,810,337 bp
T to A, chromosome 1 at 190,799,475 bp
G to A, chromosome 2 at 31,346,495 bp
A to T, chromosome 2 at 58,479,889 bp
A to T, chromosome 2 at 62,610,558 bp
G to A, chromosome 2 at 89,013,369 bp
A to T, chromosome 3 at 62,595,171 bp
T to C, chromosome 3 at 95,119,151 bp
G to A, chromosome 3 at 95,735,963 bp
T to C, chromosome 3 at 146,097,241 bp
G to A, chromosome 4 at 21,900,291 bp
G to T, chromosome 4 at 41,235,593 bp
G to C, chromosome 4 at 43,024,779 bp
A to G, chromosome 4 at 43,690,234 bp
C to T, chromosome 4 at 86,657,244 bp
A to T, chromosome 4 at 115,112,901 bp
A to T, chromosome 4 at 117,110,849 bp
A to T, chromosome 4 at 132,792,485 bp
A to G, chromosome 4 at 139,643,447 bp
T to G, chromosome 5 at 13,473,440 bp
A to C, chromosome 5 at 24,178,077 bp
A to T, chromosome 5 at 26,479,778 bp
A to T, chromosome 5 at 30,154,874 bp
A to G, chromosome 5 at 110,848,687 bp
A to G, chromosome 5 at 135,388,623 bp
G to T, chromosome 6 at 5,113,712 bp
C to T, chromosome 6 at 52,733,320 bp
T to C, chromosome 6 at 113,315,135 bp
C to T, chromosome 6 at 116,454,167 bp
C to A, chromosome 6 at 124,200,515 bp
T to C, chromosome 6 at 124,625,645 bp
A to G, chromosome 6 at 132,210,449 bp
C to A, chromosome 7 at 13,909,801 bp
T to A, chromosome 7 at 30,194,086 bp
T to A, chromosome 7 at 51,566,320 bp
A to T, chromosome 7 at 67,736,332 bp
C to T, chromosome 7 at 100,440,190 bp
A to T, chromosome 7 at 104,383,252 bp
C to A, chromosome 7 at 125,816,571 bp
T to C, chromosome 7 at 141,813,892 bp
G to A, chromosome 8 at 10,560,145 bp
G to T, chromosome 8 at 63,220,705 bp
T to A, chromosome 8 at 63,931,473 bp
G to A, chromosome 9 at 8,100,553 bp
A to C, chromosome 9 at 15,334,784 bp
G to A, chromosome 9 at 19,478,127 bp
A to T, chromosome 9 at 75,300,810 bp
CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
A to G, chromosome 9 at 106,013,302 bp
A to G, chromosome 10 at 24,223,860 bp
T to A, chromosome 10 at 43,160,831 bp
T to C, chromosome 10 at 43,510,201 bp
T to A, chromosome 10 at 74,291,001 bp
C to A, chromosome 10 at 78,576,730 bp
T to C, chromosome 11 at 69,359,899 bp
T to A, chromosome 11 at 73,589,361 bp
T to A, chromosome 11 at 74,902,088 bp
A to T, chromosome 11 at 101,529,812 bp
T to A, chromosome 11 at 115,999,799 bp
C to A, chromosome 11 at 116,073,875 bp
A to T, chromosome 12 at 8,499,388 bp
C to T, chromosome 12 at 50,489,892 bp
A to G, chromosome 12 at 85,301,848 bp
A to T, chromosome 12 at 89,254,777 bp
T to A, chromosome 13 at 13,678,190 bp
C to A, chromosome 13 at 45,557,576 bp
A to T, chromosome 14 at 30,982,333 bp
G to T, chromosome 14 at 70,240,948 bp
A to T, chromosome 14 at 121,491,239 bp
A to G, chromosome 15 at 32,460,285 bp
T to C, chromosome 16 at 37,992,196 bp
T to C, chromosome 16 at 58,718,574 bp
T to A, chromosome 16 at 62,806,636 bp
A to C, chromosome 16 at 96,028,291 bp
T to C, chromosome 17 at 20,814,529 bp
T to A, chromosome 17 at 24,511,811 bp
C to T, chromosome 17 at 25,877,791 bp
A to T, chromosome 17 at 48,393,542 bp
A to T, chromosome 17 at 71,378,257 bp
T to A, chromosome 18 at 31,711,327 bp
T to C, chromosome 18 at 32,843,885 bp
T to C, chromosome 19 at 4,169,888 bp
T to C, chromosome 19 at 6,912,829 bp
A to T, chromosome 19 at 33,964,780 bp
C to T, chromosome 19 at 38,705,339 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R1484 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
039537-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All