Strain Name:
C57BL/6J-MtgxR1484Btlr/Mmmh
Stock Number:
039537-MU
Citation ID:
RRID:MMRRC_039537-MU
Other Names:
R1484 (G1), C57BL/6J-MtgxR1484Btlr
Major Collection:

Gene Information

Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Plin2
Name: perilipin 2
Synonyms: ADPH, Adfp, Adrp, adipophilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11520
HGNC: HGNC:248
Homologene: 872
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68926
Homologene: 73649
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: Neurabin I, neurabin-I, NRB, 4930518N04Rik, A230094E16Rik, 2810430P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243725
Homologene: 14247
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Cbf-b, Sez10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Rps6kc1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: B130003F20Rik, RPK118
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320119
Homologene: 8244
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: G1-403-16, Wdr9, repro5, D530019K20Rik, 5330419I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 93871
Homologene: 23130
Bend3
Name: BEN domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 331623
VEGA: 10
Homologene: 19511
Smchd1
Name: SMC hinge domain containing 1
Synonyms: MommeD1, 4931400A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74355
Homologene: 23665
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Brpf1
Name: bromodomain and PHD finger containing, 1
Synonyms: 4930540D11Rik, 4833438B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78783
Homologene: 31251
Vps72
Name: vacuolar protein sorting 72
Synonyms: Tcfl1, YL-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21427
Homologene: 110905
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50883
Homologene: 38289
Unc13d
Name: unc-13 homolog D
Synonyms: 2610108D09Rik, Munc13-4, Jinx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70450
Homologene: 26714
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd1, A930035F14Rik, ALDH4, Ahd-1, P5CDH, Ssdh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 277939
Homologene: 19524
Capns1
Name: calpain, small subunit 1
Synonyms: Capn4, D7Ertd146e, Capa-4, Capa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12336
HGNC: HGNC:1481
Homologene: 1327
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 104662
Homologene: 5576
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224619
Homologene: 12998
Cyp4x1
Name: cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms: Cyp4a28-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 81906
Homologene: 75853
Acvr1
Name: activin A receptor, type 1
Synonyms: Acvr, SKR1, ActR-I, Alk-2, Tsk7L, ALK2, ActRIA, Acvr1a, Acvrlk2, Alk8, D330013D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11477
HGNC: HGNC:171
Homologene: 7
Vps4b
Name: vacuolar protein sorting 4B
Synonyms: 8030489C12Rik, Skd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20479
Homologene: 37976
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: D6Ertd404e, 1700069J21Rik, TXBP151, T6BP, 1200003J11Rik, D6Ertd772e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52440
Homologene: 4395
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Pom121
Name: nuclear pore membrane protein 121
Synonyms: 2610027A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 107939
Homologene: 70878
D430042O09Rik
Name: RIKEN cDNA D430042O09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233865
Homologene: 45841
Nbeal1
Name: neurobeachin like 1
Synonyms: A530083I02Rik, A530050O19Rik, 2310076G13Rik, ALS2CR17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269198
Homologene: 16453
Moxd1
Name: monooxygenase, DBH-like 1
Synonyms: 3230402N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 59012
Homologene: 22904
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319675
Homologene: 27936
Arl13b
Name: ADP-ribosylation factor-like 13B
Synonyms: A530097K21Rik, hnn, Arl2l1, C530009C10Rik, A930014M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68146
Homologene: 18820
Rhob
Name: ras homolog family member B
Synonyms: Arhb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 11852
VEGA: 12
HGNC: HGNC:668
Homologene: 68377
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: 2210005L13Rik, MGM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Pigo
Name: phosphatidylinositol glycan anchor biosynthesis, class O
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56703
Homologene: 31761
Myo16
Name: myosin XVI
Synonyms: Nyap3, BM140241, C230040D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244281
Homologene: 34710
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226652
Homologene: 18766
Prkag3
Name: protein kinase, AMP-activated, gamma 3 non-catalytic subunit
Synonyms: AMPKg3L, AMPKg3S, AMPKg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241113
HGNC: HGNC:9387
Homologene: 23006
Wdr63
Name: WD repeat domain 63
Synonyms: 4931433A13Rik, IC140, Ida7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242253
Homologene: 44922
Ush2a
Name: usherin
Synonyms: Ushrn, LOC269160, A930011D15Rik, A930037M10Rik, LOC381317, MUSH2A, Ush2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Prp7, Prp9-1, 2600010P09Rik, Chd7, Mi-2 alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Synm
Name: synemin, intermediate filament protein
Synonyms: Synemin, 4930412K21Rik, Dmn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233335
Homologene: 9081
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: 2900045C01Rik, testican 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72902
Homologene: 9662
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Nek9
Name: NIMA (never in mitosis gene a)-related expressed kinase 9
Synonyms: C130021H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217718
Homologene: 13222
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, collapsin-1, sema III, Semad, semaphorin III
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20346
Homologene: 31358
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74055
Homologene: 9478
Cep126
Name: centrosomal protein 126
Synonyms: AK129341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234915
VEGA: 9
Homologene: 28313
Sobp
Name: sine oculis binding protein
Synonyms: 5330439J01Rik, Jxc1, 2900009C16Rik, jc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 109205
Homologene: 41216
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: Vwa6, 1110001D15Rik, EG235580, Dvwa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68553
Homologene: 130754
Nrxn3
Name: neurexin III
Synonyms: 4933401A11Rik, neurexin III beta, neurexin III beta, 9330112C09Rik, neurexin III alpha, neurexin III alpha, D12Bwg0831e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Olfr1216
Name: olfactory receptor 1216
Synonyms: GA_x6K02T2Q125-50494588-50493653, MOR233-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258895
Homologene: 74241
Themis2
Name: thymocyte selection associated family member 2
Synonyms: ICB-1, BC013712
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230787
Homologene: 21009
Ppp3cc
Name: protein phosphatase 3, catalytic subunit, gamma isoform
Synonyms: Calnc, PP2BA gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19057
VEGA: 14
HGNC: HGNC:9316
Homologene: 68475
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232367
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Atxn1
Name: ataxin 1
Synonyms: 2900016G23Rik, Atx1, Sca1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
AC149051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: Semaf, M-Sema D, 9130201M22Rik, semF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Gm5598, Trim30-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434219
Ano5
Name: anoctamin 5
Synonyms: Tmem16e, Gdd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233246
Homologene: 100071
Alox5
Name: arachidonate 5-lipoxygenase
Synonyms: 5LO, 5LX, 5-LOX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11689
HGNC: HGNC:435
Homologene: 561
Nek4
Name: NIMA (never in mitosis gene a)-related expressed kinase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23955
VEGA: 14
Homologene: 2376
Stx6
Name: syntaxin 6
Synonyms: 2410005I16Rik, 2310039E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 58244
Homologene: 115622
Tmem8b
Name: transmembrane protein 8B
Synonyms: 4930500O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242409
Homologene: 72894
Olfr385
Name: olfactory receptor 385
Synonyms: MOR135-3, GA_x6K02T2P1NL-3760313-3759375
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259025
Homologene: 133670
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, Prkcm, PKD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Ecm1
Name: extracellular matrix protein 1
Synonyms: p85
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13601
HGNC: HGNC:3153
Homologene: 3260
Olfr850
Name: olfactory receptor 850
Synonyms: GA_x6K02T2PVTD-13214162-13213224, MOR147-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258516
Homologene: 121552
Prb1
Name: proline-rich protein BstNI subfamily 1
Synonyms: proline-rich proteoglycan 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381833
HGNC: HGNC:9338
Ilvbl
Name: ilvB (bacterial acetolactate synthase)-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216136
VEGA: 10
HGNC: HGNC:6041
Homologene: 68532
Ifih1
Name: interferon induced with helicase C domain 1
Synonyms: Helicard, MDA5, 9130009C22Rik, MDA-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71586
Homologene: 32535
Gpr149
Name: G protein-coupled receptor 149
Synonyms: PGR10, 9630018L10Rik, R35, Ieda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229357
Homologene: 16359
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Vmn1r229
Name: vomeronasal 1 receptor 229
Synonyms: V1re1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171224
Homologene: 74319
Gpr156
Name: G protein-coupled receptor 156
Synonyms: Gababl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239845
VEGA: 16
Homologene: 17683
Wfikkn1
Name: WAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms: Gasp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 215001
Homologene: 14244
Sult2a4
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
Synonyms: Gm5584
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434121
Homologene: 37741
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Esrra
Name: estrogen related receptor, alpha
Synonyms: ERRalpha, Nr3b1, Estrra, Err1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 26379
HGNC: HGNC:3471
Homologene: 20941
Coq3
Name: coenzyme Q3 methyltransferase
Synonyms: C77934
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230027
Homologene: 9683
Nupl2
Name: nucleoporin like 2
Synonyms: CG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231042
Homologene: 40573
4930584F24Rik
Name: RIKEN cDNA 4930584F24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75942
Slc15a1
Name: solute carrier family 15 (oligopeptide transporter), member 1
Synonyms: PEPT1, PECT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 56643
VEGA: 14
Homologene: 38006
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107239
VEGA: 19
Homologene: 26439
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 46,137,543 bp
  • T to C, chromosome 1 at 60,200,939 bp
  • T to A, chromosome 1 at 74,740,760 bp
  • T to C, chromosome 1 at 106,779,982 bp
  • A to C, chromosome 1 at 155,177,904 bp
  • G to A, chromosome 1 at 171,403,271 bp
  • G to T, chromosome 1 at 188,810,337 bp
  • T to A, chromosome 1 at 190,799,475 bp
  • G to A, chromosome 2 at 31,346,495 bp
  • A to T, chromosome 2 at 58,479,889 bp
  • A to T, chromosome 2 at 62,610,558 bp
  • G to A, chromosome 2 at 89,013,369 bp
  • A to T, chromosome 3 at 62,595,171 bp
  • T to C, chromosome 3 at 95,119,151 bp
  • G to A, chromosome 3 at 95,735,963 bp
  • T to C, chromosome 3 at 146,097,241 bp
  • G to A, chromosome 4 at 21,900,291 bp
  • G to T, chromosome 4 at 41,235,593 bp
  • G to C, chromosome 4 at 43,024,779 bp
  • A to G, chromosome 4 at 43,690,234 bp
  • C to T, chromosome 4 at 86,657,244 bp
  • A to T, chromosome 4 at 115,112,901 bp
  • A to T, chromosome 4 at 117,110,849 bp
  • A to T, chromosome 4 at 132,792,485 bp
  • A to G, chromosome 4 at 139,643,447 bp
  • T to G, chromosome 5 at 13,473,440 bp
  • A to C, chromosome 5 at 24,178,077 bp
  • A to T, chromosome 5 at 26,479,778 bp
  • A to T, chromosome 5 at 30,154,874 bp
  • A to G, chromosome 5 at 110,848,687 bp
  • A to G, chromosome 5 at 135,388,623 bp
  • G to T, chromosome 6 at 5,113,712 bp
  • C to T, chromosome 6 at 52,733,320 bp
  • T to C, chromosome 6 at 113,315,135 bp
  • C to T, chromosome 6 at 116,454,167 bp
  • C to A, chromosome 6 at 124,200,515 bp
  • T to C, chromosome 6 at 124,625,645 bp
  • A to G, chromosome 6 at 132,210,449 bp
  • C to A, chromosome 7 at 13,909,801 bp
  • T to A, chromosome 7 at 30,194,086 bp
  • T to A, chromosome 7 at 51,566,320 bp
  • A to T, chromosome 7 at 67,736,332 bp
  • C to T, chromosome 7 at 100,440,190 bp
  • A to T, chromosome 7 at 104,383,252 bp
  • C to A, chromosome 7 at 125,816,571 bp
  • T to C, chromosome 7 at 141,813,892 bp
  • G to A, chromosome 8 at 10,560,145 bp
  • G to T, chromosome 8 at 63,220,705 bp
  • T to A, chromosome 8 at 63,931,473 bp
  • G to A, chromosome 9 at 8,100,553 bp
  • A to C, chromosome 9 at 15,334,784 bp
  • G to A, chromosome 9 at 19,478,127 bp
  • A to T, chromosome 9 at 75,300,810 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 106,013,302 bp
  • A to G, chromosome 10 at 24,223,860 bp
  • T to A, chromosome 10 at 43,160,831 bp
  • T to C, chromosome 10 at 43,510,201 bp
  • T to A, chromosome 10 at 74,291,001 bp
  • C to A, chromosome 10 at 78,576,730 bp
  • T to C, chromosome 11 at 69,359,899 bp
  • T to A, chromosome 11 at 73,589,361 bp
  • T to A, chromosome 11 at 74,902,088 bp
  • A to T, chromosome 11 at 101,529,812 bp
  • T to A, chromosome 11 at 115,999,799 bp
  • C to A, chromosome 11 at 116,073,875 bp
  • A to T, chromosome 12 at 8,499,388 bp
  • C to T, chromosome 12 at 50,489,892 bp
  • A to G, chromosome 12 at 85,301,848 bp
  • A to T, chromosome 12 at 89,254,777 bp
  • T to A, chromosome 13 at 13,678,190 bp
  • C to A, chromosome 13 at 45,557,576 bp
  • A to T, chromosome 14 at 30,982,333 bp
  • G to T, chromosome 14 at 70,240,948 bp
  • A to T, chromosome 14 at 121,491,239 bp
  • A to G, chromosome 15 at 32,460,285 bp
  • T to C, chromosome 16 at 37,992,196 bp
  • T to C, chromosome 16 at 58,718,574 bp
  • T to A, chromosome 16 at 62,806,636 bp
  • A to C, chromosome 16 at 96,028,291 bp
  • T to C, chromosome 17 at 20,814,529 bp
  • T to A, chromosome 17 at 24,511,811 bp
  • C to T, chromosome 17 at 25,877,791 bp
  • A to T, chromosome 17 at 48,393,542 bp
  • A to T, chromosome 17 at 71,378,257 bp
  • T to A, chromosome 18 at 31,711,327 bp
  • T to C, chromosome 18 at 32,843,885 bp
  • T to C, chromosome 19 at 4,169,888 bp
  • T to C, chromosome 19 at 6,912,829 bp
  • A to T, chromosome 19 at 33,964,780 bp
  • C to T, chromosome 19 at 38,705,339 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1484 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039537-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.