Strain Name:
C57BL/6J-MtgxR1546Btlr/Mmmh
Stock Number:
039585-MU
Citation ID:
RRID:MMRRC_039585-MU
Other Names:
R1546 (G1), C57BL/6J-MtgxR1546Btlr
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Utrn
Name: utrophin
Synonyms: DRP, G-utrophin, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Vcan
Name: versican
Synonyms: heart defect, 5430420N07Rik, DPEAAE, PG-M, Cspg2, hdf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Prdm16
Name: PR domain containing 16
Synonyms: 5730557K01Rik, Mel1, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: Cxxc6, BB001228, 2510010B09Rik, D10Ertd17e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Ewsr1
Name: Ewing sarcoma breakpoint region 1
Synonyms: Ews
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14030
HGNC: HGNC:3508
Homologene: 134632
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, b2b1625.2Clo, Gp330, D230004K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Cwc27
Name: CWC27 spliceosome-associated protein
Synonyms: NY-CO-10, 3110009E13Rik, Sdccag10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67285
Homologene: 21192
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Npps2, PD-Ialpha, Pdnp2, ATX, Autotaxin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: Centb2, 9530039J15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Nufip2
Name: nuclear FMR1 interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68564
Homologene: 10808
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: Loa, 9930018I23Rik, dynein heavy chain, retrograde transport, Dnec1, MAP1C, Swl, Dnchc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Rtf1
Name: RTF1, Paf1/RNA polymerase II complex component
Synonyms: 6530416A09Rik, Gtl7, 2900005O08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76246
Homologene: 133868
Tspan5
Name: tetraspanin 5
Synonyms: 4930505M03Rik, NET-4, 2810455A09Rik, Tm4sf9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56224
Homologene: 4182
Dpp8
Name: dipeptidylpeptidase 8
Synonyms: 4932434F09Rik, 2310004I03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74388
VEGA: 9
Homologene: 57098
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Zfp295, Znf295, B430213I24Rik, 5430437K12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Pxk
Name: PX domain containing serine/threonine kinase
Synonyms: D14Ertd813e, MONaKA, C230080L11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218699
VEGA: 14
Homologene: 9828
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: Zubr1, 1810009A16Rik, D930005K06Rik, LOC381562, p600, A930005E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Sbf1
Name: SET binding factor 1
Synonyms: B230113C15Rik, 2610510A08Rik, Mtmr5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Ctsl
Name: cathepsin L
Synonyms: MEP, 1190035F06Rik, major excreted protein, Cat L
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: PGR27, LOC382045, Gpr114
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382045
Homologene: 17828
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Kirrel, 6720469N11Rik, Kirrel1, Neph1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Hmg20a
Name: high mobility group 20A
Synonyms: Hmgxb1, 1200004E06Rik, 5730490E10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66867
VEGA: 9
HGNC: HGNC:5001
Homologene: 32399
Itga2
Name: integrin alpha 2
Synonyms: CD49B, DX5, VLA-2 receptor, alpha 2 subunit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Ephb2
Name: Eph receptor B2
Synonyms: Drt, Nuk, Cek5, Qek5, Sek3, eteck, Prkm5, Tyro5, Hek5, Erk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Ccdc38
Name: coiled-coil domain containing 38
Synonyms: 4933417K05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237465
Homologene: 52182
Mybpc3
Name: myosin binding protein C, cardiac
Synonyms: cardiac C-protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17868
HGNC: HGNC:7551
Homologene: 215
Klhdc8a
Name: kelch domain containing 8A
Synonyms: A630065K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213417
Homologene: 10069
Rapgef5
Name: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: mr-gef, D030051B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217944
VEGA: 12
Homologene: 56563
Ppargc1b
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms: 4631412G21Rik, PGC-1beta/ERRL1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170826
Homologene: 15776
Jakmip2
Name: janus kinase and microtubule interacting protein 2
Synonyms: 6430702L21Rik, D930046L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76217
VEGA: 18
Homologene: 8866
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Dpy19l1
Name: dpy-19 like C-mannosyltransferase 1
Synonyms: 1100001I19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244745
Homologene: 14762
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Tmem30a
Name: transmembrane protein 30A
Synonyms: 2010200I23Rik, Cdc50a, D9Wsu20e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69981
Homologene: 110703
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Myo1a
Name: myosin IA
Synonyms: Myhl, BBM-I, brush border myosin 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Proc
Name: protein C
Synonyms: inactivator of coagulation factors Va, VIII, PC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Ogn
Name: osteoglycin
Synonyms: mimican, OG, 3110079A16Rik, mimecan, SLRR3A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18295
VEGA: 13
HGNC: HGNC:8126
Homologene: 8542
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268534
Homologene: 41298
AY358078
Name: cDNA sequence AY358078
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 278676
Homologene: 115686
Slc6a13
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gat2, Gabt3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14412
Homologene: 9592
Mogat2
Name: monoacylglycerol O-acyltransferase 2
Synonyms: DGAT2L5, Mgat2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233549
Homologene: 57020
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Or5ac20
Name: olfactory receptor family 5 subfamily AC member 20
Synonyms: GA_x54KRFPKG5P-55498766-55497843, Olfr202, MOR182-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258997
Homologene: 138323
Hhla1
Name: HERV-H LTR-associating 1
Synonyms: F930104E18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 654498
HGNC: HGNC:4904
Homologene: 129987
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637053
Homologene: 129754
Or8c10
Name: olfactory receptor family 8 subfamily C member 10
Synonyms: Olfr899, Olfr250, MOR170-8, MOR170-14, GA_x6K02T2MYUG-19447-18473, GA_x6K02T2PVTD-32060891-32061865
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404312
VEGA: 9
Homologene: 74151
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231642
Homologene: 18393
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Hapln2
Name: hyaluronan and proteoglycan link protein 2
Synonyms: Bral1, 4930401E20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73940
Homologene: 11045
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: Flt-4, VEGFR3, VEGFR-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Wdr77
Name: WD repeat domain 77
Synonyms: 2610003I18Rik, 2610312E17Rik, p44/MEP50
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70465
Homologene: 11466
Carf
Name: calcium response factor
Synonyms: Als2cr8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241066
Homologene: 11689
Gm13547
Name: predicted gene 13547
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 433416
Homologene: 136350
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: hyperpolarization-activated, cyclic nucleotide-gated K+ 1, C630013B14Rik, HAC2, Bcng1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Vmn2r97
Name: vomeronasal 2, receptor 97
Synonyms: EG627367
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627367
Homologene: 115024
Bco2
Name: beta-carotene oxygenase 2
Synonyms: CMO2, Bcmo2, Bcdo2, beta-diox-II, B-diox-II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 170752
Homologene: 12912
Ms4a3
Name: membrane-spanning 4-domains, subfamily A, member 3
Synonyms: haematopoietic cell-specific transmembrane-4, HTm4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170813
HGNC: HGNC:7317
Homologene: 4472
Morc4
Name: microrchidia 4
Synonyms: 5630401M14Rik, Zcwcc2, 1600017G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 75746
Homologene: 11644
Gm572
Name: predicted gene 572
Synonyms: b2b1167Clo, LOC230909
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230909
Homologene: 52134
2510039O18Rik
Name: RIKEN cDNA 2510039O18 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77034
Homologene: 12668
Aaas
Name: achalasia, adrenocortical insufficiency, alacrimia
Synonyms: Aladin, GL003, D030041N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223921
VEGA: 15
Homologene: 9232
H2ac8
Name: H2A clustered histone 8
Synonyms: Hist1h2ae
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319166
Homologene: 136768
Esrra
Name: estrogen related receptor, alpha
Synonyms: Err1, ERRalpha, Nr3b1, Estrra
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26379
HGNC: HGNC:3471
Homologene: 20941
Tmem184a
Name: transmembrane protein 184a
Synonyms: Sdmg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231832
Homologene: 64815
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,126,036 bp
  • T to G, chromosome 1 at 132,302,935 bp
  • A to G, chromosome 1 at 140,431,378 bp
  • A to G, chromosome 2 at 29,763,909 bp
  • A to G, chromosome 2 at 36,091,037 bp
  • C to T, chromosome 2 at 69,502,610 bp
  • T to A, chromosome 2 at 76,719,052 bp
  • A to G, chromosome 2 at 91,132,780 bp
  • G to A, chromosome 2 at 119,705,426 bp
  • T to C, chromosome 3 at 36,870,056 bp
  • C to T, chromosome 3 at 64,406,888 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to A, chromosome 3 at 88,024,097 bp
  • C to T, chromosome 3 at 105,964,439 bp
  • A to T, chromosome 3 at 138,898,341 bp
  • C to T, chromosome 4 at 136,771,009 bp
  • T to A, chromosome 4 at 139,416,927 bp
  • T to C, chromosome 4 at 147,941,775 bp
  • A to T, chromosome 4 at 148,666,819 bp
  • C to A, chromosome 4 at 154,528,660 bp
  • A to T, chromosome 5 at 24,555,428 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to A, chromosome 5 at 139,808,537 bp
  • A to G, chromosome 6 at 37,050,203 bp
  • A to G, chromosome 6 at 38,190,655 bp
  • T to G, chromosome 6 at 121,332,374 bp
  • A to T, chromosome 7 at 87,437,992 bp
  • A to G, chromosome 7 at 99,232,559 bp
  • A to T, chromosome 7 at 144,595,427 bp
  • A to T, chromosome 8 at 94,941,630 bp
  • G to A, chromosome 8 at 121,604,263 bp
  • A to T, chromosome 9 at 24,475,384 bp
  • A to T, chromosome 9 at 38,367,548 bp
  • A to G, chromosome 9 at 50,550,629 bp
  • T to A, chromosome 9 at 56,467,401 bp
  • C to T, chromosome 9 at 65,063,493 bp
  • A to G, chromosome 9 at 71,725,815 bp
  • A to G, chromosome 9 at 79,771,288 bp
  • C to A, chromosome 10 at 12,436,364 bp
  • G to A, chromosome 10 at 62,432,446 bp
  • A to T, chromosome 10 at 62,812,910 bp
  • A to T, chromosome 10 at 93,565,879 bp
  • A to G, chromosome 10 at 127,712,624 bp
  • C to A, chromosome 11 at 5,078,574 bp
  • G to T, chromosome 11 at 49,631,981 bp
  • T to A, chromosome 11 at 77,691,606 bp
  • C to A, chromosome 12 at 30,288,296 bp
  • G to A, chromosome 12 at 84,648,508 bp
  • C to A, chromosome 12 at 110,649,457 bp
  • A to G, chromosome 12 at 117,647,101 bp
  • A to G, chromosome 13 at 23,570,945 bp
  • A to T, chromosome 13 at 49,609,333 bp
  • A to G, chromosome 13 at 64,367,879 bp
  • A to G, chromosome 13 at 89,692,956 bp
  • G to A, chromosome 13 at 95,046,443 bp
  • A to C, chromosome 13 at 104,802,185 bp
  • A to T, chromosome 13 at 114,849,420 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 13 at 117,975,766 bp
  • A to G, chromosome 14 at 8,164,091 bp
  • T to A, chromosome 14 at 21,008,950 bp
  • T to G, chromosome 14 at 31,147,714 bp
  • C to T, chromosome 14 at 51,820,419 bp
  • A to G, chromosome 14 at 60,756,408 bp
  • C to T, chromosome 15 at 54,845,829 bp
  • C to T, chromosome 15 at 65,933,327 bp
  • A to G, chromosome 15 at 89,307,157 bp
  • C to A, chromosome 15 at 102,346,718 bp
  • C to A, chromosome 16 at 31,104,936 bp
  • T to C, chromosome 16 at 44,501,639 bp
  • T to C, chromosome 16 at 59,284,003 bp
  • A to T, chromosome 16 at 97,952,027 bp
  • T to A, chromosome 17 at 18,947,848 bp
  • T to C, chromosome 17 at 81,648,247 bp
  • C to T, chromosome 18 at 32,127,410 bp
  • T to A, chromosome 18 at 43,546,938 bp
  • A to T, chromosome 18 at 61,310,606 bp
  • T to C, chromosome 19 at 6,920,297 bp
  • T to C, chromosome 19 at 11,632,907 bp
  • G to A, chromosome X at 139,837,845 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1546 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039585-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.