Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1546Btlr/Mmmh
Stock Number:
039585-MU
Citation ID:
RRID:MMRRC_039585-MU
Other Names:
R1546 (G1), C57BL/6J-MtgxR1546Btlr
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,126,036 bp
  • T to G, chromosome 1 at 132,302,935 bp
  • A to G, chromosome 1 at 140,431,378 bp
  • A to G, chromosome 2 at 29,763,909 bp
  • A to G, chromosome 2 at 36,091,037 bp
  • C to T, chromosome 2 at 69,502,610 bp
  • T to A, chromosome 2 at 76,719,052 bp
  • A to G, chromosome 2 at 91,132,780 bp
  • G to A, chromosome 2 at 119,705,426 bp
  • T to C, chromosome 3 at 36,870,056 bp
  • C to T, chromosome 3 at 64,406,888 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to A, chromosome 3 at 88,024,097 bp
  • C to T, chromosome 3 at 105,964,439 bp
  • A to T, chromosome 3 at 138,898,341 bp
  • C to T, chromosome 4 at 136,771,009 bp
  • T to A, chromosome 4 at 139,416,927 bp
  • T to C, chromosome 4 at 147,941,775 bp
  • A to T, chromosome 4 at 148,666,819 bp
  • C to A, chromosome 4 at 154,528,660 bp
  • A to T, chromosome 5 at 24,555,428 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to A, chromosome 5 at 139,808,537 bp
  • A to G, chromosome 6 at 37,050,203 bp
  • A to G, chromosome 6 at 38,190,655 bp
  • T to G, chromosome 6 at 121,332,374 bp
  • A to T, chromosome 7 at 87,437,992 bp
  • A to G, chromosome 7 at 99,232,559 bp
  • A to T, chromosome 7 at 144,595,427 bp
  • A to T, chromosome 8 at 94,941,630 bp
  • G to A, chromosome 8 at 121,604,263 bp
  • A to T, chromosome 9 at 24,475,384 bp
  • A to T, chromosome 9 at 38,367,548 bp
  • A to G, chromosome 9 at 50,550,629 bp
  • T to A, chromosome 9 at 56,467,401 bp
  • C to T, chromosome 9 at 65,063,493 bp
  • A to G, chromosome 9 at 71,725,815 bp
  • A to G, chromosome 9 at 79,771,288 bp
  • C to A, chromosome 10 at 12,436,364 bp
  • G to A, chromosome 10 at 62,432,446 bp
  • A to T, chromosome 10 at 62,812,910 bp
  • A to T, chromosome 10 at 93,565,879 bp
  • A to G, chromosome 10 at 127,712,624 bp
  • C to A, chromosome 11 at 5,078,574 bp
  • G to T, chromosome 11 at 49,631,981 bp
  • T to A, chromosome 11 at 77,691,606 bp
  • C to A, chromosome 12 at 30,288,296 bp
  • G to A, chromosome 12 at 84,648,508 bp
  • C to A, chromosome 12 at 110,649,457 bp
  • A to G, chromosome 12 at 117,647,101 bp
  • A to G, chromosome 13 at 23,570,945 bp
  • A to T, chromosome 13 at 49,609,333 bp
  • A to G, chromosome 13 at 64,367,879 bp
  • A to G, chromosome 13 at 89,692,956 bp
  • G to A, chromosome 13 at 95,046,443 bp
  • A to C, chromosome 13 at 104,802,185 bp
  • A to T, chromosome 13 at 114,849,420 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 13 at 117,975,766 bp
  • A to G, chromosome 14 at 8,164,091 bp
  • T to A, chromosome 14 at 21,008,950 bp
  • T to G, chromosome 14 at 31,147,714 bp
  • C to T, chromosome 14 at 51,820,419 bp
  • A to G, chromosome 14 at 60,756,408 bp
  • C to T, chromosome 15 at 54,845,829 bp
  • C to T, chromosome 15 at 65,933,327 bp
  • A to G, chromosome 15 at 89,307,157 bp
  • C to A, chromosome 15 at 102,346,718 bp
  • C to A, chromosome 16 at 31,104,936 bp
  • T to C, chromosome 16 at 44,501,639 bp
  • T to C, chromosome 16 at 59,284,003 bp
  • A to T, chromosome 16 at 97,952,027 bp
  • T to A, chromosome 17 at 18,947,848 bp
  • T to C, chromosome 17 at 81,648,247 bp
  • C to T, chromosome 18 at 32,127,410 bp
  • T to A, chromosome 18 at 43,546,938 bp
  • A to T, chromosome 18 at 61,310,606 bp
  • T to C, chromosome 19 at 6,920,297 bp
  • T to C, chromosome 19 at 11,632,907 bp
  • G to A, chromosome X at 139,837,845 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1546 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039585-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.