Strain Name:
C57BL/6J-MtgxR1648Btlr/Mmmh
Stock Number:
039684-MU
Citation ID:
RRID:MMRRC_039684-MU
Other Names:
R1648 (G1), C57BL/6J-MtgxR1648Btlr
Major Collection:

Gene Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77569
Homologene: 18953
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170753
Homologene: 64370
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 21853
Homologene: 31206
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101540
Homologene: 9516
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230967
Homologene: 44919
Kif20b
Name: kinesin family member 20B
Synonyms: Mphosph1, Kif20b, magoo, 33cex, N-6 kinesin, C330014J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, GMAP-210, TRIP230, 6030460N08Rik, 2610511G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109181
Homologene: 20897
Iars
Name: isoleucine-tRNA synthetase
Synonyms: 2510016L12Rik, E430001P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ERa, Estr, ESR, ERalpha, ER-alpha, Nr3a1, ER[a], Estra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Casp3
Name: caspase 3
Synonyms: mldy, CC3, CPP32, A830040C14Rik, Apopain, Caspase-3, Yama, AC-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12367
HGNC: HGNC:1504
Homologene: 37912
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 2810487N22Rik, 4632407J06Rik, B130055D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Ankrd27
Name: ankyrin repeat domain 27 (VPS9 domain)
Synonyms: Varp, D330003H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 245886
Homologene: 12956
Klc1
Name: kinesin light chain 1
Synonyms: Kns2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16593
HGNC: HGNC:6387
Homologene: 4056
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Sdf4
Name: stromal cell derived factor 4
Synonyms: Cab45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20318
Homologene: 32121
Eif2ak3
Name: eukaryotic translation initiation factor 2 alpha kinase 3
Synonyms: PERK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13666
HGNC: HGNC:3255
Homologene: 3557
Ddx20
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Synonyms: dp103, GEMIN3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53975
HGNC: HGNC:2743
Homologene: 5214
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71389
Homologene: 32772
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59015
Homologene: 32509
Tusc3
Name: tumor suppressor candidate 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 80286
Homologene: 6937
Cep170b
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Prrg4
Name: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms: TMG4, 9930111I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228413
Homologene: 11451
Gemin5
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216766
Homologene: 9155
Ehbp1
Name: EH domain binding protein 1
Synonyms: KIAA0903-like, Flj21950
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216565
Homologene: 22880
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: zTNF4, TALL-1, D8Ertd387e, BLyS, BAFF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 24099
Homologene: 48443
Akap6
Name: A kinase (PRKA) anchor protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Atp10a
Name: ATPase, class V, type 10A
Synonyms: Atp10c, pfatp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11982
Homologene: 56461
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, Nphp8, fantom, 1700047E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244585
Homologene: 18296
Abca4
Name: ATP-binding cassette, sub-family A (ABC1), member 4
Synonyms: Rim protein, D430003I15Rik, RmP, Abc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Kif17
Name: kinesin family member 17
Synonyms: Kif17b, N-4 kinesin, 5930435E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16559
Homologene: 5883
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210510
Homologene: 19364
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Ankrd7
Name: ankyrin repeat domain 7
Synonyms: 4930532L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75196
Homologene: 35506
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238455
Homologene: 18813
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp-delta, Nalp9b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243874
Homologene: 18530
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210876
Homologene: 86604
4921528O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Abcc9
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Synonyms: SUR2B, Sur2, SUR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231646
Homologene: 82639
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 277468
Homologene: 17654
Zfp607a
Name: zinc finger protein 607A
Synonyms: Zfp607, 4732475C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545938
Homologene: 134321
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215772
Homologene: 100289
Tmem30a
Name: transmembrane protein 30A
Synonyms: D9Wsu20e, Cdc50a, 2010200I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69981
Homologene: 110703
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: Sli, ShcB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216148
Homologene: 19127
Tmem132c
Name: transmembrane protein 132C
Synonyms: 2810482M11Rik, 4632425D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208213
Homologene: 76567
Postn
Name: periostin, osteoblast specific factor
Synonyms: peri, A630052E07Rik, Periostin, Osf2, OSF-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 50706
Homologene: 4730
Neto1
Name: neuropilin (NRP) and tolloid (TLL)-like 1
Synonyms: C130005O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246317
VEGA: 18
Homologene: 16367
Smcp
Name: sperm mitochondria-associated cysteine-rich protein
Synonyms: Mcsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17235
HGNC: HGNC:6962
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 50770
Homologene: 75050
Has1
Name: hyaluronan synthase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15116
VEGA: 17
HGNC: HGNC:4818
Homologene: 1165
D130040H23Rik
Name: RIKEN cDNA D130040H23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 211135
Homologene: 138403
Dcaf7
Name: DDB1 and CUL4 associated factor 7
Synonyms: 1700012F10Rik, Wdr68, 2610037L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71833
Homologene: 55930
Krt7
Name: keratin 7
Synonyms: K7, Krt2-7, Cytokeratin 7, D15Wsu77e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233271
Homologene: 45618
G930045G22Rik
Name: RIKEN cDNA G930045G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Olfr642
Name: olfactory receptor 642
Synonyms: GA_x6K02T2PBJ9-6784380-6783436, MOR13-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258326
Homologene: 17196
Hk3
Name: hexokinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212032
HGNC: HGNC:4925
Homologene: 55633
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: 90kDa, 1110069D02Rik, MSK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
Eif2b5
Name: eukaryotic translation initiation factor 2B, subunit 5 epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224045
HGNC: HGNC:3261
Homologene: 2903
Sgpp1
Name: sphingosine-1-phosphate phosphatase 1
Synonyms: SPP1, SPP, mSPP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 81535
VEGA: 12
Homologene: 101696
Plcxd3
Name: phosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms: B130016O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239318
Homologene: 45574
Olfr1436
Name: olfactory receptor 1436
Synonyms: MOR214-2, GA_x6K02T2RE5P-2634596-2633658
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258682
Homologene: 83129
Olfr519
Name: olfactory receptor 519
Synonyms: GA_x6K02T2PBJ9-11224559-11223615, MOR268-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 277935
Homologene: 17186
Tmem170b
Name: transmembrane protein 170B
Synonyms: EG621976
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 621976
VEGA: 13
Homologene: 73249
Rinl
Name: Ras and Rab interactor-like
Synonyms: 5830482F20Rik, 9930116N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320435
Homologene: 18556
Sbspon
Name: somatomedin B and thrombospondin, type 1 domain containing
Synonyms: Gm106, LOC226866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226866
Homologene: 45950
Gm13703
Name: predicted gene 13703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Rtkn
Name: rhotekin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20166
Homologene: 7522
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233005
Homologene: 69128
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,883,759 bp
  • T to G, chromosome 1 at 163,046,056 bp
  • T to C, chromosome 2 at 14,451,992 bp
  • T to C, chromosome 2 at 73,364,164 bp
  • T to C, chromosome 2 at 90,710,088 bp
  • C to A, chromosome 2 at 104,832,743 bp
  • A to T, chromosome 2 at 118,723,780 bp
  • A to G, chromosome 2 at 161,042,058 bp
  • A to T, chromosome 3 at 9,471,039 bp
  • A to G, chromosome 3 at 54,376,101 bp
  • A to T, chromosome 3 at 92,584,481 bp
  • T to C, chromosome 3 at 105,679,188 bp
  • G to A, chromosome 3 at 122,084,104 bp
  • A to G, chromosome 3 at 138,069,420 bp
  • A to G, chromosome 4 at 138,269,895 bp
  • G to A, chromosome 4 at 153,979,096 bp
  • G to A, chromosome 4 at 155,999,429 bp
  • T to A, chromosome 5 at 21,813,976 bp
  • T to A, chromosome 5 at 66,999,256 bp
  • T to A, chromosome 5 at 96,726,613 bp
  • G to T, chromosome 5 at 114,336,275 bp
  • T to A, chromosome 5 at 127,463,056 bp
  • A to T, chromosome 6 at 18,868,428 bp
  • T to C, chromosome 6 at 50,846,718 bp
  • T to A, chromosome 6 at 70,883,631 bp
  • T to C, chromosome 6 at 83,135,994 bp
  • T to C, chromosome 6 at 85,678,402 bp
  • ACCCCCCCCCCCCCC to ACCCCCCCCCCCCCCCCCC,AACCCCCCCCCCCCCCC, chromosome 6 at 142,594,681 bp
  • T to A, chromosome 7 at 16,857,807 bp
  • T to A, chromosome 7 at 20,026,544 bp
  • T to C, chromosome 7 at 26,932,368 bp
  • T to C, chromosome 7 at 27,879,068 bp
  • C to T, chromosome 7 at 28,797,632 bp
  • T to A, chromosome 7 at 35,603,853 bp
  • T to A, chromosome 7 at 55,264,270 bp
  • T to C, chromosome 7 at 58,784,827 bp
  • A to G, chromosome 7 at 104,050,169 bp
  • A to G, chromosome 7 at 108,893,765 bp
  • T to C, chromosome 8 at 10,031,534 bp
  • C to T, chromosome 8 at 12,847,495 bp
  • C to A, chromosome 8 at 39,046,567 bp
  • T to C, chromosome 8 at 46,638,074 bp
  • C to A, chromosome 8 at 69,302,981 bp
  • A to C, chromosome 8 at 91,252,889 bp
  • C to T, chromosome 9 at 27,063,469 bp
  • A to G, chromosome 9 at 79,793,029 bp
  • A to G, chromosome 10 at 5,001,260 bp
  • A to G, chromosome 10 at 10,395,371 bp
  • T to A, chromosome 10 at 79,626,111 bp
  • A to T, chromosome 10 at 128,249,444 bp
  • G to A, chromosome 11 at 22,096,000 bp
  • A to T, chromosome 11 at 58,147,979 bp
  • T to A, chromosome 11 at 106,051,802 bp
  • T to C, chromosome 12 at 17,548,537 bp
  • A to T, chromosome 12 at 53,142,006 bp
  • T to A, chromosome 12 at 75,716,216 bp
  • T to A, chromosome 12 at 101,884,392 bp
  • T to C, chromosome 12 at 111,776,887 bp
  • C to T, chromosome 12 at 112,736,372 bp
  • T to C, chromosome 12 at 119,446,421 bp
  • A to T, chromosome 13 at 41,606,262 bp
  • A to G, chromosome 13 at 49,723,002 bp
  • A to G, chromosome 13 at 55,014,461 bp
  • A to T, chromosome 15 at 4,375,809 bp
  • T to C, chromosome 15 at 90,994,367 bp
  • A to C, chromosome 15 at 101,412,567 bp
  • T to C, chromosome 16 at 20,502,585 bp
  • A to G, chromosome 17 at 17,849,985 bp
  • A to T, chromosome 17 at 22,569,061 bp
  • A to C, chromosome 17 at 43,627,109 bp
  • A to G, chromosome 18 at 12,532,199 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • A to T, chromosome 18 at 86,500,054 bp
  • C to A, chromosome 19 at 6,839,362 bp
  • T to A, chromosome 19 at 12,298,659 bp
  • A to T, chromosome 19 at 34,936,790 bp
  • A to G, chromosome 19 at 47,955,405 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1648 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.