Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1648Btlr/Mmmh
Stock Number:
039684-MU
Citation ID:
RRID:MMRRC_039684-MU
Other Names:
R1648 (G1), C57BL/6J-MtgxR1648Btlr
Major Collection:

Strain Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Casp3
Name: caspase 3
Synonyms: CPP32, Apopain, Yama, Caspase-3, A830040C14Rik, CC3, mldy, AC-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12367
HGNC: HGNC:1504
Homologene: 37912
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Ankrd27
Name: ankyrin repeat domain 27
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245886
Homologene: 12956
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Sdf4
Name: stromal cell derived factor 4
Synonyms: Cab45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20318
Homologene: 32121
Eif2ak3
Name: eukaryotic translation initiation factor 2 alpha kinase 3
Synonyms: PERK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13666
HGNC: HGNC:3255
Homologene: 3557
Ddx20
Name: DEAD box helicase 20
Synonyms: GEMIN3, dp103, DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53975
HGNC: HGNC:2743
Homologene: 5214
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Tusc3
Name: tumor suppressor candidate 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80286
Homologene: 6937
Cep170b
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Prrg4
Name: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
Synonyms: TMG4, 9930111I18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228413
Homologene: 11451
Gemin5
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216766
Homologene: 9155
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24099
Homologene: 48443
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Kif17
Name: kinesin family member 17
Synonyms: N-4 kinesin, 5930435E01Rik, Kif17b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16559
Homologene: 5883
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Ankrd7
Name: ankyrin repeat domain 7
Synonyms: 4930532L20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75196
Homologene: 35506
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243874
Homologene: 18530
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
4921528O07Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Zfp607a
Name: zinc finger protein 607A
Synonyms: 4732475C15Rik, Zfp607
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545938
Homologene: 134321
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Tmem30a
Name: transmembrane protein 30A
Synonyms: 2010200I23Rik, D9Wsu20e, Cdc50a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69981
Homologene: 110703
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: ShcB, Sli
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216148
Homologene: 19127
Tmem132c
Name: transmembrane protein 132C
Synonyms: 4632425D07Rik, 2810482M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208213
Homologene: 76567
Postn
Name: periostin, osteoblast specific factor
Synonyms: OSF-2, Periostin, Osf2, peri, A630052E07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50706
Homologene: 4730
Neto1
Name: neuropilin (NRP) and tolloid (TLL)-like 1
Synonyms: C130005O10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246317
VEGA: 18
Homologene: 16367
Smcp
Name: sperm mitochondria-associated cysteine-rich protein
Synonyms: Mcsp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17235
HGNC: HGNC:6962
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Has1
Name: hyaluronan synthase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15116
VEGA: 17
HGNC: HGNC:4818
Homologene: 1165
Zfp781a
Name: zinc finger protein 781A
Synonyms: D130040H23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211135
Homologene: 138403
Dcaf7
Name: DDB1 and CUL4 associated factor 7
Synonyms: 2610037L01Rik, 1700012F10Rik, Wdr68
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71833
Homologene: 55930
Krt7
Name: keratin 7
Synonyms: K7, D15Wsu77e, Cytokeratin 7, Krt2-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233271
Homologene: 45618
G930045G22Rik
Name: RIKEN cDNA G930045G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Or51a10
Name: olfactory receptor family 51 subfamily A member 10
Synonyms: GA_x6K02T2PBJ9-6784380-6783436, MOR13-6, Olfr642
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258326
Homologene: 17196
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: MSK2, 1110069D02Rik, 90kDa
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
Eif2b5
Name: eukaryotic translation initiation factor 2B, subunit 5 epsilon
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224045
HGNC: HGNC:3261
Homologene: 2903
Sgpp1
Name: sphingosine-1-phosphate phosphatase 1
Synonyms: mSPP1, SPP1, SPP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 81535
VEGA: 12
Homologene: 101696
Plcxd3
Name: phosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms: B130016O10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239318
Homologene: 45574
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: GA_x6K02T2PBJ9-11224559-11223615, MOR268-6, Olfr519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Tmem170b
Name: transmembrane protein 170B
Synonyms: EG621976
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 621976
VEGA: 13
Homologene: 73249
Rinl
Name: Ras and Rab interactor-like
Synonyms: 9930116N10Rik, 5830482F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320435
Homologene: 18556
Sbspon
Name: somatomedin B and thrombospondin, type 1 domain containing
Synonyms: LOC226866, Gm106
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226866
Homologene: 45950
Gm13703
Name: predicted gene 13703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233005
Homologene: 69128
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,883,759 bp
  • T to G, chromosome 1 at 163,046,056 bp
  • T to C, chromosome 2 at 14,451,992 bp
  • T to C, chromosome 2 at 73,364,164 bp
  • T to C, chromosome 2 at 90,710,088 bp
  • C to A, chromosome 2 at 104,832,743 bp
  • A to T, chromosome 2 at 118,723,780 bp
  • A to G, chromosome 2 at 161,042,058 bp
  • A to T, chromosome 3 at 9,471,039 bp
  • A to G, chromosome 3 at 54,376,101 bp
  • A to T, chromosome 3 at 92,584,481 bp
  • T to C, chromosome 3 at 105,679,188 bp
  • G to A, chromosome 3 at 122,084,104 bp
  • A to G, chromosome 3 at 138,069,420 bp
  • A to G, chromosome 4 at 138,269,895 bp
  • G to A, chromosome 4 at 153,979,096 bp
  • G to A, chromosome 4 at 155,999,429 bp
  • T to A, chromosome 5 at 21,813,976 bp
  • T to A, chromosome 5 at 66,999,256 bp
  • T to A, chromosome 5 at 96,726,613 bp
  • G to T, chromosome 5 at 114,336,275 bp
  • T to A, chromosome 5 at 127,463,056 bp
  • A to T, chromosome 6 at 18,868,428 bp
  • T to C, chromosome 6 at 50,846,718 bp
  • T to A, chromosome 6 at 70,883,631 bp
  • T to C, chromosome 6 at 83,135,994 bp
  • T to C, chromosome 6 at 85,678,402 bp
  • ACCCCCCCCCCCCCC to ACCCCCCCCCCCCCCCCCC,AACCCCCCCCCCCCCCC, chromosome 6 at 142,594,681 bp
  • T to A, chromosome 7 at 16,857,807 bp
  • T to A, chromosome 7 at 20,026,544 bp
  • T to C, chromosome 7 at 26,932,368 bp
  • T to C, chromosome 7 at 27,879,068 bp
  • C to T, chromosome 7 at 28,797,632 bp
  • T to A, chromosome 7 at 35,603,853 bp
  • T to A, chromosome 7 at 55,264,270 bp
  • T to C, chromosome 7 at 58,784,827 bp
  • A to G, chromosome 7 at 104,050,169 bp
  • A to G, chromosome 7 at 108,893,765 bp
  • T to C, chromosome 8 at 10,031,534 bp
  • C to T, chromosome 8 at 12,847,495 bp
  • C to A, chromosome 8 at 39,046,567 bp
  • T to C, chromosome 8 at 46,638,074 bp
  • C to A, chromosome 8 at 69,302,981 bp
  • A to C, chromosome 8 at 91,252,889 bp
  • C to T, chromosome 9 at 27,063,469 bp
  • A to G, chromosome 9 at 79,793,029 bp
  • A to G, chromosome 10 at 5,001,260 bp
  • A to G, chromosome 10 at 10,395,371 bp
  • T to A, chromosome 10 at 79,626,111 bp
  • A to T, chromosome 10 at 128,249,444 bp
  • G to A, chromosome 11 at 22,096,000 bp
  • A to T, chromosome 11 at 58,147,979 bp
  • T to A, chromosome 11 at 106,051,802 bp
  • T to C, chromosome 12 at 17,548,537 bp
  • A to T, chromosome 12 at 53,142,006 bp
  • T to A, chromosome 12 at 75,716,216 bp
  • T to A, chromosome 12 at 101,884,392 bp
  • T to C, chromosome 12 at 111,776,887 bp
  • C to T, chromosome 12 at 112,736,372 bp
  • T to C, chromosome 12 at 119,446,421 bp
  • A to T, chromosome 13 at 41,606,262 bp
  • A to G, chromosome 13 at 49,723,002 bp
  • A to G, chromosome 13 at 55,014,461 bp
  • A to T, chromosome 15 at 4,375,809 bp
  • T to C, chromosome 15 at 90,994,367 bp
  • A to C, chromosome 15 at 101,412,567 bp
  • T to C, chromosome 16 at 20,502,585 bp
  • A to G, chromosome 17 at 17,849,985 bp
  • A to T, chromosome 17 at 22,569,061 bp
  • A to C, chromosome 17 at 43,627,109 bp
  • A to G, chromosome 18 at 12,532,199 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • A to T, chromosome 18 at 86,500,054 bp
  • C to A, chromosome 19 at 6,839,362 bp
  • T to A, chromosome 19 at 12,298,659 bp
  • A to T, chromosome 19 at 34,936,790 bp
  • A to G, chromosome 19 at 47,955,405 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1648 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.