Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1648Btlr/Mmmh
Stock Number:
039684-MU
Citation ID:
RRID:MMRRC_039684-MU
Other Names:
R1648 (G1), C57BL/6J-MtgxR1648Btlr
Major Collection:

Strain Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,883,759 bp
  • T to G, chromosome 1 at 163,046,056 bp
  • T to C, chromosome 2 at 14,451,992 bp
  • T to C, chromosome 2 at 73,364,164 bp
  • T to C, chromosome 2 at 90,710,088 bp
  • C to A, chromosome 2 at 104,832,743 bp
  • A to T, chromosome 2 at 118,723,780 bp
  • A to G, chromosome 2 at 161,042,058 bp
  • A to T, chromosome 3 at 9,471,039 bp
  • A to G, chromosome 3 at 54,376,101 bp
  • A to T, chromosome 3 at 92,584,481 bp
  • T to C, chromosome 3 at 105,679,188 bp
  • G to A, chromosome 3 at 122,084,104 bp
  • A to G, chromosome 3 at 138,069,420 bp
  • A to G, chromosome 4 at 138,269,895 bp
  • G to A, chromosome 4 at 153,979,096 bp
  • G to A, chromosome 4 at 155,999,429 bp
  • T to A, chromosome 5 at 21,813,976 bp
  • T to A, chromosome 5 at 66,999,256 bp
  • T to A, chromosome 5 at 96,726,613 bp
  • G to T, chromosome 5 at 114,336,275 bp
  • T to A, chromosome 5 at 127,463,056 bp
  • A to T, chromosome 6 at 18,868,428 bp
  • T to C, chromosome 6 at 50,846,718 bp
  • T to A, chromosome 6 at 70,883,631 bp
  • T to C, chromosome 6 at 83,135,994 bp
  • T to C, chromosome 6 at 85,678,402 bp
  • ACCCCCCCCCCCCCC to ACCCCCCCCCCCCCCCCCC,AACCCCCCCCCCCCCCC, chromosome 6 at 142,594,681 bp
  • T to A, chromosome 7 at 16,857,807 bp
  • T to A, chromosome 7 at 20,026,544 bp
  • T to C, chromosome 7 at 26,932,368 bp
  • T to C, chromosome 7 at 27,879,068 bp
  • C to T, chromosome 7 at 28,797,632 bp
  • T to A, chromosome 7 at 35,603,853 bp
  • T to A, chromosome 7 at 55,264,270 bp
  • T to C, chromosome 7 at 58,784,827 bp
  • A to G, chromosome 7 at 104,050,169 bp
  • A to G, chromosome 7 at 108,893,765 bp
  • T to C, chromosome 8 at 10,031,534 bp
  • C to T, chromosome 8 at 12,847,495 bp
  • C to A, chromosome 8 at 39,046,567 bp
  • T to C, chromosome 8 at 46,638,074 bp
  • C to A, chromosome 8 at 69,302,981 bp
  • A to C, chromosome 8 at 91,252,889 bp
  • C to T, chromosome 9 at 27,063,469 bp
  • A to G, chromosome 9 at 79,793,029 bp
  • A to G, chromosome 10 at 5,001,260 bp
  • A to G, chromosome 10 at 10,395,371 bp
  • T to A, chromosome 10 at 79,626,111 bp
  • A to T, chromosome 10 at 128,249,444 bp
  • G to A, chromosome 11 at 22,096,000 bp
  • A to T, chromosome 11 at 58,147,979 bp
  • T to A, chromosome 11 at 106,051,802 bp
  • T to C, chromosome 12 at 17,548,537 bp
  • A to T, chromosome 12 at 53,142,006 bp
  • T to A, chromosome 12 at 75,716,216 bp
  • T to A, chromosome 12 at 101,884,392 bp
  • T to C, chromosome 12 at 111,776,887 bp
  • C to T, chromosome 12 at 112,736,372 bp
  • T to C, chromosome 12 at 119,446,421 bp
  • A to T, chromosome 13 at 41,606,262 bp
  • A to G, chromosome 13 at 49,723,002 bp
  • A to G, chromosome 13 at 55,014,461 bp
  • A to T, chromosome 15 at 4,375,809 bp
  • T to C, chromosome 15 at 90,994,367 bp
  • A to C, chromosome 15 at 101,412,567 bp
  • T to C, chromosome 16 at 20,502,585 bp
  • A to G, chromosome 17 at 17,849,985 bp
  • A to T, chromosome 17 at 22,569,061 bp
  • A to C, chromosome 17 at 43,627,109 bp
  • A to G, chromosome 18 at 12,532,199 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • A to T, chromosome 18 at 86,500,054 bp
  • C to A, chromosome 19 at 6,839,362 bp
  • T to A, chromosome 19 at 12,298,659 bp
  • A to T, chromosome 19 at 34,936,790 bp
  • A to G, chromosome 19 at 47,955,405 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1648 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.