Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1667Btlr/Mmmh
Stock Number:
039703-MU
Citation ID:
RRID:MMRRC_039703-MU
Other Names:
R1667 (G1), C57BL/6J-MtgxR1667Btlr
Major Collection:

Strain Information

Mon1b
Name: MON1 homolog B, secretory traffciking associated
Synonyms: 5033413H12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270096
Homologene: 69174
Ascl1
Name: achaete-scute family bHLH transcription factor 1
Synonyms: ASH1, Mash1, bHLHa46
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17172
HGNC: HGNC:738
Homologene: 31234
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Psmd13
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: S11, 26S proteasome subunit p40.5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23997
HGNC: HGNC:9558
Homologene: 2110
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: GALT, alpha Gal, Gal, glycoprotein alpha galactosyl transferase 1, alpha3GalT, Ggta-1, Ggta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,186,757 bp
  • T to A, chromosome 1 at 75,410,549 bp
  • G to T, chromosome 1 at 87,192,967 bp
  • A to G, chromosome 1 at 88,095,935 bp
  • A to G, chromosome 1 at 132,456,919 bp
  • T to C, chromosome 1 at 140,105,523 bp
  • A to G, chromosome 1 at 184,036,858 bp
  • T to C, chromosome 2 at 9,877,549 bp
  • T to A, chromosome 2 at 35,414,283 bp
  • A to G, chromosome 2 at 60,420,257 bp
  • A to G, chromosome 2 at 86,298,736 bp
  • G to A, chromosome 2 at 118,641,189 bp
  • G to A, chromosome 2 at 120,270,150 bp
  • ATAGTGGAATTGTTCAAACTC to ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC, chromosome 2 at 121,548,730 bp
  • A to G, chromosome 2 at 163,075,696 bp
  • A to G, chromosome 2 at 165,001,703 bp
  • T to C, chromosome 3 at 16,204,892 bp
  • T to C, chromosome 3 at 34,650,419 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • T to A, chromosome 3 at 136,093,296 bp
  • A to T, chromosome 4 at 98,413,027 bp
  • A to T, chromosome 4 at 114,191,564 bp
  • A to T, chromosome 4 at 114,194,781 bp
  • A to G, chromosome 4 at 116,222,317 bp
  • A to G, chromosome 4 at 134,358,156 bp
  • A to T, chromosome 4 at 144,393,036 bp
  • A to T, chromosome 4 at 147,583,950 bp
  • C to T, chromosome 4 at 152,313,215 bp
  • G to T, chromosome 5 at 41,816,775 bp
  • T to C, chromosome 5 at 114,786,733 bp
  • T to A, chromosome 5 at 120,521,082 bp
  • T to C, chromosome 6 at 40,677,044 bp
  • T to A, chromosome 6 at 56,956,753 bp
  • T to A, chromosome 7 at 34,365,654 bp
  • A to T, chromosome 7 at 85,857,681 bp
  • A to T, chromosome 7 at 107,097,770 bp
  • G to A, chromosome 7 at 139,845,648 bp
  • T to A, chromosome 7 at 140,890,609 bp
  • T to C, chromosome 8 at 45,400,837 bp
  • A to G, chromosome 8 at 53,608,939 bp
  • A to C, chromosome 8 at 65,001,464 bp
  • T to C, chromosome 8 at 83,233,721 bp
  • T to A, chromosome 8 at 85,305,285 bp
  • G to A, chromosome 8 at 93,056,904 bp
  • T to A, chromosome 8 at 94,292,687 bp
  • A to C, chromosome 8 at 94,389,366 bp
  • T to A, chromosome 8 at 95,033,373 bp
  • T to G, chromosome 8 at 113,641,957 bp
  • A to T, chromosome 9 at 53,500,932 bp
  • A to T, chromosome 9 at 105,432,797 bp
  • G to T, chromosome 9 at 110,085,445 bp
  • G to C, chromosome 9 at 110,085,446 bp
  • T to C, chromosome 10 at 87,492,793 bp
  • T to C, chromosome 10 at 90,511,184 bp
  • G to T, chromosome 10 at 107,813,965 bp
  • T to C, chromosome 11 at 58,316,095 bp
  • A to T, chromosome 11 at 72,445,217 bp
  • G to A, chromosome 11 at 87,807,241 bp
  • A to G, chromosome 11 at 107,983,946 bp
  • A to G, chromosome 11 at 116,947,377 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to A, chromosome 12 at 104,217,440 bp
  • T to A, chromosome 13 at 16,026,624 bp
  • T to A, chromosome 13 at 77,759,516 bp
  • A to G, chromosome 13 at 86,045,884 bp
  • T to A, chromosome 13 at 93,498,370 bp
  • A to T, chromosome 13 at 117,603,073 bp
  • T to C, chromosome 14 at 20,404,157 bp
  • A to G, chromosome 14 at 54,724,849 bp
  • T to A, chromosome 14 at 55,618,796 bp
  • T to A, chromosome 15 at 34,378,732 bp
  • A to T, chromosome 15 at 89,140,141 bp
  • T to C, chromosome 16 at 20,637,838 bp
  • T to C, chromosome 16 at 30,571,352 bp
  • T to G, chromosome 17 at 28,523,961 bp
  • A to T, chromosome 17 at 71,911,567 bp
  • T to C, chromosome 18 at 19,991,560 bp
  • T to C, chromosome 18 at 32,203,792 bp
  • A to G, chromosome 19 at 7,467,801 bp
  • T to A, chromosome 19 at 9,557,766 bp
  • A to G, chromosome 19 at 39,643,590 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1667 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039703-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.