Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1667Btlr/Mmmh
Stock Number:
039703-MU
Citation ID:
RRID:MMRRC_039703-MU
Other Names:
R1667 (G1), C57BL/6J-MtgxR1667Btlr
Major Collection:

Strain Information

Mon1b
Name: MON1 homolog B, secretory traffciking associated
Synonyms: 5033413H12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270096
Homologene: 69174
Ascl1
Name: achaete-scute family bHLH transcription factor 1
Synonyms: ASH1, Mash1, bHLHa46
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17172
HGNC: HGNC:738
Homologene: 31234
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Psmd13
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: S11, 26S proteasome subunit p40.5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23997
HGNC: HGNC:9558
Homologene: 2110
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: GALT, alpha Gal, Gal, glycoprotein alpha galactosyl transferase 1, alpha3GalT, Ggta-1, Ggta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Frmd5
Name: FERM domain containing 5
Synonyms: 1500032A09Rik, A930004K21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228564
Homologene: 18206
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Ythdf3
Name: YTH N6-methyladenosine RNA binding protein 3
Synonyms: 9130022A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229096
Homologene: 34991
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, ATP2C1A, PMR1, 1700121J11Rik, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433804
Homologene: 133076
Arb2a
Name: ARB2 cotranscriptional regulator A
Synonyms: pEN87, 53-E6, 2610318O14Rik, 9430037D06Rik, 1110033M05Rik, Fam172a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68675
VEGA: 13
Homologene: 12933
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Mybbp1a
Name: MYB binding protein (P160) 1a
Synonyms: p67MBP, p160MBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18432
HGNC: HGNC:7546
Homologene: 40954
Sox2
Name: SRY (sex determining region Y)-box 2
Synonyms: Sox-2, lcc, ysb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20674
Homologene: 68298
Lsg1
Name: large 60S subunit nuclear export GTPase 1
Synonyms: D16Bwg1547e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224092
Homologene: 5917
Bub1b
Name: BUB1B, mitotic checkpoint serine/threonine kinase
Synonyms: BUBR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12236
HGNC: HGNC:1149
Homologene: 933
Map3k2
Name: mitogen-activated protein kinase kinase kinase 2
Synonyms: Mekk2, MEK kinase 2, 9630061B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26405
VEGA: 18
HGNC: HGNC:6854
Homologene: 74576
Lsm14a
Name: LSM14A mRNA processing body assembly factor
Synonyms: 2700023B17Rik, Tral
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67070
Homologene: 40537
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142980
Homologene: 20696
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268510
Homologene: 27821
Rec8
Name: REC8 meiotic recombination protein
Synonyms: mrec, Rec8L1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56739
Homologene: 3768
Slc7a8
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
Synonyms: LAT2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50934
VEGA: 14
Homologene: 8166
Cfap70
Name: cilia and flagella associated protein 70
Synonyms: 5330402L21Rik, Ttc18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76670
Homologene: 17048
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Inhba
Name: inhibin beta-A
Synonyms: activin beta-A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16323
VEGA: 13
HGNC: HGNC:6066
Homologene: 1653
Gata3
Name: GATA binding protein 3
Synonyms: Gata-3, jal
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14462
HGNC: HGNC:4172
Homologene: 1550
Trim60
Name: tripartite motif-containing 60
Synonyms: 2czf45, Rnf33
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234329
Homologene: 51876
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170756
Homologene: 41602
Ece2
Name: endothelin converting enzyme 2
Synonyms: 6330509A19Rik, 9630025D12Rik, 1810009K13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107522
Homologene: 56679
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: C76116, 4933431N12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71310
Homologene: 57079
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Achr-4, Acrd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Dhx30
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
AC132131.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Mapk12
Name: mitogen-activated protein kinase 12
Synonyms: Sapk3, Erk6, P38gamma, Prkm12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29857
VEGA: 15
HGNC: HGNC:6874
Homologene: 55705
Adgrg3
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Pik3r3
Name: phosphoinositide-3-kinase regulatory subunit 3
Synonyms: p55pik, p55
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18710
HGNC: HGNC:8981
Homologene: 2690
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Alk
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: 2A1, antitrypsin, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Stxbp3-ps
Name: syntaxin-binding protein 3, pseudogene
Synonyms: Munc18c(L), Stxbp3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 619371
Jmy
Name: junction-mediating and regulatory protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 57748
VEGA: 13
Homologene: 10955
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Rnf207
Name: ring finger protein 207
Synonyms: D330010C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433809
Homologene: 19234
Zfp672
Name: zinc finger protein 672
Synonyms: 4930488P06Rik, 4930511N19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319475
Homologene: 23493
Dusp10
Name: dual specificity phosphatase 10
Synonyms: MKP-5, 2610306G15Rik, MKP5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63953
HGNC: HGNC:3065
Homologene: 5215
Or5j3
Name: olfactory receptor family 5 subfamily J member 3
Synonyms: GA_x6K02T2Q125-47777498-47778436, MOR172-1, Olfr1052
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259012
Homologene: 79679
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
HGNC: HGNC:1863
Homologene: 117484
Ncoa5
Name: nuclear receptor coactivator 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228869
Homologene: 32496
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Neil3
Name: nei like 3 (E. coli)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234258
Homologene: 10094
Vmn1r4
Name: vomeronasal 1 receptor 4
Synonyms: C230065D10Rik, V1rc21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171194
Homologene: 131060
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230623
Homologene: 136292
Or10a4
Name: olfactory receptor family 10 subfamily A member 4
Synonyms: P2, MOR263-5, GA_x6K02T2PBJ9-9470146-9471093, Olfr17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18314
Homologene: 23241
Cyp2c67
Name: cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms: C730004C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545288
Homologene: 74936
Adgra1
Name: adhesion G protein-coupled receptor A1
Synonyms: 2900059M17Rik, D7Ertd680e, Gpr123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52389
Homologene: 18582
Pla2g4d
Name: phospholipase A2, group IVD
Synonyms: 2610311B01Rik, Pla2delta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78390
Homologene: 52252
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Ugt1a7c
Name: UDP glucuronosyltransferase 1 family, polypeptide A7C
Synonyms: A10'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394432
Homologene: 136043
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Cox7c
Name: cytochrome c oxidase subunit 7C
Synonyms: COXVIIc, Cox7c1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12867
HGNC: HGNC:2292
Homologene: 81691
E230001N04Rik
Name: RIKEN cDNA E230001N04 gene
Synonyms: Lnc956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320187
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,186,757 bp
  • T to A, chromosome 1 at 75,410,549 bp
  • G to T, chromosome 1 at 87,192,967 bp
  • A to G, chromosome 1 at 88,095,935 bp
  • A to G, chromosome 1 at 132,456,919 bp
  • T to C, chromosome 1 at 140,105,523 bp
  • A to G, chromosome 1 at 184,036,858 bp
  • T to C, chromosome 2 at 9,877,549 bp
  • T to A, chromosome 2 at 35,414,283 bp
  • A to G, chromosome 2 at 60,420,257 bp
  • A to G, chromosome 2 at 86,298,736 bp
  • G to A, chromosome 2 at 118,641,189 bp
  • G to A, chromosome 2 at 120,270,150 bp
  • ATAGTGGAATTGTTCAAACTC to ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC, chromosome 2 at 121,548,730 bp
  • A to G, chromosome 2 at 163,075,696 bp
  • A to G, chromosome 2 at 165,001,703 bp
  • T to C, chromosome 3 at 16,204,892 bp
  • T to C, chromosome 3 at 34,650,419 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • T to A, chromosome 3 at 136,093,296 bp
  • A to T, chromosome 4 at 98,413,027 bp
  • A to T, chromosome 4 at 114,191,564 bp
  • A to T, chromosome 4 at 114,194,781 bp
  • A to G, chromosome 4 at 116,222,317 bp
  • A to G, chromosome 4 at 134,358,156 bp
  • A to T, chromosome 4 at 144,393,036 bp
  • A to T, chromosome 4 at 147,583,950 bp
  • C to T, chromosome 4 at 152,313,215 bp
  • G to T, chromosome 5 at 41,816,775 bp
  • T to C, chromosome 5 at 114,786,733 bp
  • T to A, chromosome 5 at 120,521,082 bp
  • T to C, chromosome 6 at 40,677,044 bp
  • T to A, chromosome 6 at 56,956,753 bp
  • T to A, chromosome 7 at 34,365,654 bp
  • A to T, chromosome 7 at 85,857,681 bp
  • A to T, chromosome 7 at 107,097,770 bp
  • G to A, chromosome 7 at 139,845,648 bp
  • T to A, chromosome 7 at 140,890,609 bp
  • T to C, chromosome 8 at 45,400,837 bp
  • A to G, chromosome 8 at 53,608,939 bp
  • A to C, chromosome 8 at 65,001,464 bp
  • T to C, chromosome 8 at 83,233,721 bp
  • T to A, chromosome 8 at 85,305,285 bp
  • G to A, chromosome 8 at 93,056,904 bp
  • T to A, chromosome 8 at 94,292,687 bp
  • A to C, chromosome 8 at 94,389,366 bp
  • T to A, chromosome 8 at 95,033,373 bp
  • T to G, chromosome 8 at 113,641,957 bp
  • A to T, chromosome 9 at 53,500,932 bp
  • A to T, chromosome 9 at 105,432,797 bp
  • G to T, chromosome 9 at 110,085,445 bp
  • G to C, chromosome 9 at 110,085,446 bp
  • T to C, chromosome 10 at 87,492,793 bp
  • T to C, chromosome 10 at 90,511,184 bp
  • G to T, chromosome 10 at 107,813,965 bp
  • T to C, chromosome 11 at 58,316,095 bp
  • A to T, chromosome 11 at 72,445,217 bp
  • G to A, chromosome 11 at 87,807,241 bp
  • A to G, chromosome 11 at 107,983,946 bp
  • A to G, chromosome 11 at 116,947,377 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to A, chromosome 12 at 104,217,440 bp
  • T to A, chromosome 13 at 16,026,624 bp
  • T to A, chromosome 13 at 77,759,516 bp
  • A to G, chromosome 13 at 86,045,884 bp
  • T to A, chromosome 13 at 93,498,370 bp
  • A to T, chromosome 13 at 117,603,073 bp
  • T to C, chromosome 14 at 20,404,157 bp
  • A to G, chromosome 14 at 54,724,849 bp
  • T to A, chromosome 14 at 55,618,796 bp
  • T to A, chromosome 15 at 34,378,732 bp
  • A to T, chromosome 15 at 89,140,141 bp
  • T to C, chromosome 16 at 20,637,838 bp
  • T to C, chromosome 16 at 30,571,352 bp
  • T to G, chromosome 17 at 28,523,961 bp
  • A to T, chromosome 17 at 71,911,567 bp
  • T to C, chromosome 18 at 19,991,560 bp
  • T to C, chromosome 18 at 32,203,792 bp
  • A to G, chromosome 19 at 7,467,801 bp
  • T to A, chromosome 19 at 9,557,766 bp
  • A to G, chromosome 19 at 39,643,590 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1667 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039703-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text