Strain Name:
C57BL/6J-MtgxR1694Btlr/Mmmh
Stock Number:
039727-MU
Citation ID:
RRID:MMRRC_039727-MU
Other Names:
R1694 (G1), C57BL/6J-MtgxR1694Btlr
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, DPEAAE, Cspg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20562
Homologene: 2302
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230935
Homologene: 14558
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78244
Homologene: 6752
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, Fnbp2, 9930124L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14270
Homologene: 52683
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71728
Homologene: 12406
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, Nav1.6, NaCh6, nmf335, NMF335, nur14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20273
Homologene: 7927
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105689
Homologene: 9005
Armc1
Name: armadillo repeat containing 1
Synonyms: 2900046P06Rik, C330014L16Rik, 2310016N05Rik, 3110009G21Rik, Arcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74252
Homologene: 10015
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2900069C24Rik, LRRN4, LRN, 2810008P14Rik, SAP25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Xrcc5
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22596
VEGA: 1
Homologene: 40681
Sf3b1
Name: splicing factor 3b, subunit 1
Synonyms: SAP155, Prp10, SF3b155, 2810001M05Rik, Targ4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 81898
Homologene: 6696
Prr12
Name: proline rich 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233210
Homologene: 18957
Xpo1
Name: exportin 1
Synonyms: Crm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103573
Homologene: 2554
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Set
Name: SET nuclear oncogene
Synonyms: StF-IT-1, 2610030F17Rik, 5730420M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56086
Homologene: 55707
Ufd1
Name: ubiquitin recognition factor in ER-associated degradation 1
Synonyms: Ufd1, Ufd1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 22230
Homologene: 39090
Pcmtd1
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Synonyms: 8430411F12Rik, A030012M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319263
Homologene: 14180
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 207932
Homologene: 45941
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Dlx6
Name: distal-less homeobox 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13396
HGNC: HGNC:2919
Homologene: 87855
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Dact1
Name: dishevelled-binding antagonist of beta-catenin 1
Synonyms: THYEX3, Frodo, Frd1, Frodo1, Dapper1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 59036
Homologene: 9613
Magoh
Name: mago homolog, exon junction complex core component
Synonyms: Mago-m, Mos2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17149
HGNC: HGNC:6815
Homologene: 1776
Vdac1
Name: voltage-dependent anion channel 1
Synonyms: Vdac5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22333
Homologene: 107244
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Mlh1
Name: mutL homolog 1
Synonyms: colon cancer, nonpolyposis type 2, 1110035C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17350
HGNC: HGNC:7127
Homologene: 208
Neo1
Name: neogenin
Synonyms: D930014N22Rik, 2610028H22Rik, Igdcc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Rtn1
Name: reticulon 1
Synonyms: Nsp, Rtn1-b, Rtn1-c, 0710005K15Rik, Rtn1-a, 4930441F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104001
Homologene: 49654
Casr
Name: calcium-sensing receptor
Synonyms: CaR, Gprc2a, cation sensing receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12374
HGNC: HGNC:1514
Homologene: 332
Ptger1
Name: prostaglandin E receptor 1 (subtype EP1)
Synonyms: EP1, Ptgerep1, 42kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19216
HGNC: HGNC:9593
Homologene: 738
Tfrc
Name: transferrin receptor
Synonyms: CD71, Mtvr-1, Mtvr1, E430033M20Rik, 2610028K12Rik, p90, Trfr, TfR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 22042
Homologene: 2429
Fbxo32
Name: F-box protein 32
Synonyms: 4833442G10Rik, ATROGIN1, MAFbx, atrogin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67731
VEGA: 15
Homologene: 12182
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Scaf4
Name: SR-related CTD-associated factor 4
Synonyms: Sra4, Sfrs15, Srsf15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224432
VEGA: 16
Homologene: 16227
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20741
Homologene: 295
Scimp
Name: SLP adaptor and CSK interacting membrane protein
Synonyms: A430084P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327957
Homologene: 52602
Akap5
Name: A kinase (PRKA) anchor protein 5
Synonyms: LOC238276, AKAP150, 3526401B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238276
HGNC: HGNC:375
Homologene: 15854
Mansc1
Name: MANSC domain containing 1
Synonyms: 9130403P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67729
Homologene: 49522
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20779
Homologene: 21120
Sqstm1
Name: sequestosome 1
Synonyms: A170, OSF-6, STAP, Osi, p62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18412
Homologene: 31202
Zfp410
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Nup58
Name: nucleoporin 58
Synonyms: 1700017F11Rik, Nupl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71844
VEGA: 14
Homologene: 40924
Spats2
Name: spermatogenesis associated, serine-rich 2
Synonyms: 2700012F11Rik, p59scr, 59kDa, Scr59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72572
VEGA: 15
Homologene: 11314
Arhgap44
Name: Rho GTPase activating protein 44
Synonyms: AU040829
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216831
Homologene: 65284
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239102
Homologene: 52657
Abca16
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233810
Homologene: 132942
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: alpha3(IV), tumstatin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26875
Homologene: 69111
Srrm3
Name: serine/arginine repetitive matrix 3
Synonyms: 2900083I11Rik, SRm300-like, Srrm2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58212
Homologene: 136723
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 637515
Homologene: 19080
Dpysl3
Name: dihydropyrimidinase-like 3
Synonyms: Ulip1, Ulip, CRMP-4, TUC4, 9430041P20Rik, CRMP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 22240
HGNC: HGNC:3015
Homologene: 20361
Zfp560
Name: zinc finger protein 560
Synonyms: 2310030G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 434377
Homologene: 103820
Calcrl
Name: calcitonin receptor-like
Synonyms: CRLR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 54598
Homologene: 21179
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 260315
Homologene: 56688
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
D130062J21Rik
Name: RIKEN cDNA D130062J21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Cfap206
Name: cilia and flagella associated protein 206
Synonyms: 1700003M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69329
Homologene: 18713
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 665270
Homologene: 82108
Or55b3
Name: olfactory receptor family 55 subfamily B member 3
Synonyms: GA_x6K02T2PBJ9-5199377-5198367, MOR42-2, Olfr543
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257947
Homologene: 81631
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Otud7a
Name: OTU domain containing 7A
Synonyms: Cezanne 2 protein, Otud7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170711
Homologene: 15642
Ephb3
Name: Eph receptor B3
Synonyms: Sek4, MDK5, HEK2, Etk2, Tyro6, Cek10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78914
Homologene: 6098
Exoc3
Name: exocyst complex component 3
Synonyms: E430013E20Rik, Sec6l1, 2810050O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Ceacam10
Name: CEA cell adhesion molecule 10
Synonyms: Bgp3, Cea10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26366
Trmt11
Name: tRNA methyltransferase 11
Synonyms: 3110045I18Rik, 2410075D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73681
VEGA: 10
Homologene: 6876
Rtp4
Name: receptor transporter protein 4
Synonyms: 5830458K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67775
Homologene: 56944
Zfp775
Name: zinc finger protein 775
Synonyms: C130032F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243372
Homologene: 37089
4921513I03Rik
Name: RIKEN cDNA 4921513I03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70874
VEGA: 10
Grik1
Name: glutamate receptor, ionotropic, kainate 1
Synonyms: Glur-5, Glur5, D16Ium24, A830007B11Rik, D16Ium24e, Glurbeta1, GluK5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14805
HGNC: HGNC:4579
Homologene: 68992
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54563
Homologene: 41286
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Naalad2
Name: N-acetylated alpha-linked acidic dipeptidase 2
Synonyms: NAALADASE2, NAADALASE2, D9Ertd285e, GCPIII, GCP3, Folh1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72560
Homologene: 3294
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Efcab14
Name: EF-hand calcium binding domain 14
Synonyms: 4732418C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230648
Homologene: 8858
Tor1aip2
Name: torsin A interacting protein 2
Synonyms: 15kDa, 1110020D10Rik, LULL1, Ifrg15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240832
Homologene: 17028
Fbxl2
Name: F-box and leucine-rich repeat protein 2
Synonyms: 2810423A21Rik, Fbl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72179
Homologene: 135814
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240816
Homologene: 129962
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Akr1c21
Name: aldo-keto reductase family 1, member C21
Synonyms: 9430025F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 77337
Homologene: 134114
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269233
Homologene: 19521
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67722
Homologene: 69412
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271813
Homologene: 11715
Tex55
Name: testis expressed 55
Synonyms: 4930435E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74663
Homologene: 17614
Pdcl2
Name: phosducin-like 2
Synonyms: 1700016K07Rik, 1700010B22Rik, Mgcphlp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 79455
Homologene: 74832
Sgce
Name: sarcoglycan, epsilon
Synonyms: e-SG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20392
Homologene: 31205
Agbl5
Name: ATP/GTP binding protein-like 5
Synonyms: 9430057O19Rik, Ccp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231093
Homologene: 11053
Plekhd1
Name: pleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms: 3830431G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217682
Homologene: 15090
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: 4933402B14Rik, Gm6095, 4921529N20Rik, Tmem146
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 338354
Homologene: 85969
Fam90a1a
Name: family with sequence similarity 90, member A1A
Synonyms: C86695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 97476
Homologene: 135718
Vmn2r76
Name: vomeronasal 2, receptor 76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 675969
Homologene: 104330
Mdfic2
Name: MyoD family inhibitor domain containing 2
Synonyms: LOC330390, Gm765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330390
Homologene: 66631
Gm10000
Name: predicted gene 10000
Synonyms: Gm10000, DIGIT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 791311
VEGA: 12
Padi1
Name: peptidyl arginine deiminase, type I
Synonyms: Pdi1, Pad type 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18599
Homologene: 7881
4930447C04Rik
Name: RIKEN cDNA 4930447C04 gene
Synonyms: Six6as, Six6os1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75801
Homologene: 49922
Or9r7
Name: olfactory receptor family 9 subfamily R member 7
Synonyms: GA_x6K02T2PULF-11797746-11796799, MOR210-3, Olfr824
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258669
Homologene: 45026
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226565
Homologene: 68130
Or5an11
Name: olfactory receptor family 5 subfamily AN member 11
Synonyms: GA_x6K02T2LL2P-1028-792, GA_x6K02T057QT-4025-4642, GA_x6K02T03CT6-1-477, MOR214-3, MOR214-3, Olfr245, Olfr232, Olfr235
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258681
Slc4a1ap
Name: solute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonyms: kanadaptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20534
Homologene: 7543
C1qbp
Name: complement component 1, q subcomponent binding protein
Synonyms: P32, HABP1, D11Wsu182e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12261
HGNC: HGNC:1243
Homologene: 31023
Comtd1
Name: catechol-O-methyltransferase domain containing 1
Synonyms: 1810030M08Rik, MT773
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 69156
Homologene: 41703
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
Mad2l1bp
Name: MAD2L1 binding protein
Synonyms: 0610009D16Rik, CMT2B, CMT2A, 2510031P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66591
VEGA: 17
Homologene: 11990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 7,147,648 bp
  • C to G, chromosome 1 at 55,019,395 bp
  • C to T, chromosome 1 at 72,319,096 bp
  • C to T, chromosome 1 at 75,527,386 bp
  • A to T, chromosome 1 at 82,690,663 bp
  • T to C, chromosome 1 at 119,783,510 bp
  • A to C, chromosome 1 at 131,289,750 bp
  • C to T, chromosome 1 at 153,804,676 bp
  • A to T, chromosome 1 at 156,065,285 bp
  • T to C, chromosome 1 at 162,922,672 bp
  • A to G, chromosome 2 at 3,225,623 bp
  • A to G, chromosome 2 at 30,069,424 bp
  • A to G, chromosome 2 at 60,441,084 bp
  • A to T, chromosome 2 at 84,339,287 bp
  • A to G, chromosome 2 at 90,801,320 bp
  • A to T, chromosome 2 at 155,613,193 bp
  • A to G, chromosome 2 at 157,469,755 bp
  • A to G, chromosome 3 at 19,134,886 bp
  • A to C, chromosome 3 at 87,804,062 bp
  • A to G, chromosome 4 at 9,610,869 bp
  • A to G, chromosome 4 at 32,244,656 bp
  • G to T, chromosome 4 at 34,719,058 bp
  • G to T, chromosome 4 at 107,883,165 bp
  • A to G, chromosome 4 at 115,746,539 bp
  • A to G, chromosome 4 at 140,819,885 bp
  • T to A, chromosome 4 at 151,979,273 bp
  • A to G, chromosome 5 at 14,520,963 bp
  • A to G, chromosome 5 at 30,893,382 bp
  • G to C, chromosome 5 at 31,543,754 bp
  • A to G, chromosome 5 at 32,317,277 bp
  • A to G, chromosome 5 at 76,319,282 bp
  • A to G, chromosome 5 at 135,873,225 bp
  • A to G, chromosome 5 at 137,638,461 bp
  • A to G, chromosome 6 at 4,689,709 bp
  • T to C, chromosome 6 at 6,867,173 bp
  • A to G, chromosome 6 at 48,619,455 bp
  • A to C, chromosome 6 at 91,062,803 bp
  • A to C, chromosome 6 at 98,238,139 bp
  • A to T, chromosome 6 at 134,610,860 bp
  • T to A, chromosome 7 at 24,781,066 bp
  • T to A, chromosome 7 at 27,964,383 bp
  • C to A, chromosome 7 at 45,028,579 bp
  • C to A, chromosome 7 at 63,733,710 bp
  • A to G, chromosome 7 at 86,230,148 bp
  • A to T, chromosome 7 at 102,477,340 bp
  • A to G, chromosome 7 at 120,520,084 bp
  • G to A, chromosome 7 at 143,808,012 bp
  • T to C, chromosome 8 at 21,962,987 bp
  • G to A, chromosome 8 at 83,668,478 bp
  • T to A, chromosome 9 at 18,327,387 bp
  • C to A, chromosome 9 at 20,347,986 bp
  • A to T, chromosome 9 at 58,880,603 bp
  • A to G, chromosome 9 at 107,930,008 bp
  • A to G, chromosome 9 at 111,228,475 bp
  • A to T, chromosome 9 at 114,003,171 bp
  • T to C, chromosome 10 at 7,701,945 bp
  • T to C, chromosome 10 at 30,535,225 bp
  • T to C, chromosome 10 at 74,594,163 bp
  • T to A, chromosome 10 at 109,714,414 bp
  • T to C, chromosome 10 at 120,778,628 bp
  • T to A, chromosome 10 at 130,126,254 bp
  • CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
  • A to G, chromosome 11 at 23,281,399 bp
  • A to G, chromosome 11 at 50,207,480 bp
  • G to C, chromosome 11 at 52,374,363 bp
  • A to G, chromosome 11 at 65,053,197 bp
  • G to T, chromosome 11 at 65,954,824 bp
  • G to T, chromosome 11 at 70,793,792 bp
  • G to T, chromosome 11 at 70,978,247 bp
  • A to G, chromosome 11 at 71,216,855 bp
  • T to C, chromosome 11 at 101,532,099 bp
  • A to G, chromosome 12 at 51,744,592 bp
  • A to G, chromosome 12 at 55,841,600 bp
  • C to A, chromosome 12 at 71,312,777 bp
  • T to C, chromosome 12 at 72,223,524 bp
  • C to T, chromosome 12 at 72,885,218 bp
  • C to T, chromosome 12 at 76,329,924 bp
  • G to T, chromosome 12 at 76,604,012 bp
  • A to G, chromosome 12 at 80,722,321 bp
  • C to T, chromosome 12 at 84,325,720 bp
  • T to C, chromosome 12 at 85,267,141 bp
  • T to C, chromosome 12 at 104,476,600 bp
  • A to G, chromosome 13 at 4,575,178 bp
  • T to G, chromosome 13 at 13,661,161 bp
  • C to T, chromosome 13 at 74,190,065 bp
  • A to T, chromosome 13 at 89,688,483 bp
  • A to G, chromosome 14 at 21,847,330 bp
  • G to C, chromosome 14 at 55,073,944 bp
  • A to T, chromosome 14 at 60,244,670 bp
  • T to C, chromosome 14 at 103,227,511 bp
  • A to T, chromosome 15 at 10,451,563 bp
  • G to T, chromosome 15 at 58,192,258 bp
  • C to T, chromosome 15 at 99,149,940 bp
  • C to A, chromosome 15 at 100,955,528 bp
  • A to T, chromosome 16 at 17,295,376 bp
  • T to A, chromosome 16 at 18,821,173 bp
  • A to G, chromosome 16 at 21,221,745 bp
  • A to T, chromosome 16 at 22,806,675 bp
  • T to C, chromosome 16 at 23,613,120 bp
  • T to A, chromosome 16 at 32,614,625 bp
  • A to T, chromosome 16 at 36,495,591 bp
  • A to G, chromosome 16 at 38,827,135 bp
  • T to A, chromosome 16 at 87,950,068 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • A to G, chromosome 16 at 90,767,040 bp
  • A to G, chromosome 17 at 46,152,844 bp
  • G to C, chromosome 17 at 56,662,850 bp
  • A to G, chromosome 17 at 75,225,285 bp
  • A to G, chromosome 18 at 10,136,094 bp
  • C to A, chromosome 18 at 43,328,374 bp
  • T to A, chromosome 19 at 12,268,917 bp
  • A to G, chromosome 19 at 38,180,225 bp
  • A to G, chromosome 19 at 41,637,592 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1694 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039727-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.