Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1694Btlr/Mmmh
Stock Number:
039727-MU
Citation ID:
RRID:MMRRC_039727-MU
Other Names:
R1694 (G1), C57BL/6J-MtgxR1694Btlr
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230935
Homologene: 14558
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 7,147,648 bp
  • C to G, chromosome 1 at 55,019,395 bp
  • C to T, chromosome 1 at 72,319,096 bp
  • C to T, chromosome 1 at 75,527,386 bp
  • A to T, chromosome 1 at 82,690,663 bp
  • T to C, chromosome 1 at 119,783,510 bp
  • A to C, chromosome 1 at 131,289,750 bp
  • C to T, chromosome 1 at 153,804,676 bp
  • A to T, chromosome 1 at 156,065,285 bp
  • T to C, chromosome 1 at 162,922,672 bp
  • A to G, chromosome 2 at 3,225,623 bp
  • A to G, chromosome 2 at 30,069,424 bp
  • A to G, chromosome 2 at 60,441,084 bp
  • A to T, chromosome 2 at 84,339,287 bp
  • A to G, chromosome 2 at 90,801,320 bp
  • A to T, chromosome 2 at 155,613,193 bp
  • A to G, chromosome 2 at 157,469,755 bp
  • A to G, chromosome 3 at 19,134,886 bp
  • A to C, chromosome 3 at 87,804,062 bp
  • A to G, chromosome 4 at 9,610,869 bp
  • A to G, chromosome 4 at 32,244,656 bp
  • G to T, chromosome 4 at 34,719,058 bp
  • G to T, chromosome 4 at 107,883,165 bp
  • A to G, chromosome 4 at 115,746,539 bp
  • A to G, chromosome 4 at 140,819,885 bp
  • T to A, chromosome 4 at 151,979,273 bp
  • A to G, chromosome 5 at 14,520,963 bp
  • A to G, chromosome 5 at 30,893,382 bp
  • G to C, chromosome 5 at 31,543,754 bp
  • A to G, chromosome 5 at 32,317,277 bp
  • A to G, chromosome 5 at 76,319,282 bp
  • A to G, chromosome 5 at 135,873,225 bp
  • A to G, chromosome 5 at 137,638,461 bp
  • A to G, chromosome 6 at 4,689,709 bp
  • T to C, chromosome 6 at 6,867,173 bp
  • A to G, chromosome 6 at 48,619,455 bp
  • A to C, chromosome 6 at 91,062,803 bp
  • A to C, chromosome 6 at 98,238,139 bp
  • A to T, chromosome 6 at 134,610,860 bp
  • T to A, chromosome 7 at 24,781,066 bp
  • T to A, chromosome 7 at 27,964,383 bp
  • C to A, chromosome 7 at 45,028,579 bp
  • C to A, chromosome 7 at 63,733,710 bp
  • A to G, chromosome 7 at 86,230,148 bp
  • A to T, chromosome 7 at 102,477,340 bp
  • A to G, chromosome 7 at 120,520,084 bp
  • G to A, chromosome 7 at 143,808,012 bp
  • T to C, chromosome 8 at 21,962,987 bp
  • G to A, chromosome 8 at 83,668,478 bp
  • T to A, chromosome 9 at 18,327,387 bp
  • C to A, chromosome 9 at 20,347,986 bp
  • A to T, chromosome 9 at 58,880,603 bp
  • A to G, chromosome 9 at 107,930,008 bp
  • A to G, chromosome 9 at 111,228,475 bp
  • A to T, chromosome 9 at 114,003,171 bp
  • T to C, chromosome 10 at 7,701,945 bp
  • T to C, chromosome 10 at 30,535,225 bp
  • T to C, chromosome 10 at 74,594,163 bp
  • T to A, chromosome 10 at 109,714,414 bp
  • T to C, chromosome 10 at 120,778,628 bp
  • T to A, chromosome 10 at 130,126,254 bp
  • CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
  • A to G, chromosome 11 at 23,281,399 bp
  • A to G, chromosome 11 at 50,207,480 bp
  • G to C, chromosome 11 at 52,374,363 bp
  • A to G, chromosome 11 at 65,053,197 bp
  • G to T, chromosome 11 at 65,954,824 bp
  • G to T, chromosome 11 at 70,793,792 bp
  • G to T, chromosome 11 at 70,978,247 bp
  • A to G, chromosome 11 at 71,216,855 bp
  • T to C, chromosome 11 at 101,532,099 bp
  • A to G, chromosome 12 at 51,744,592 bp
  • A to G, chromosome 12 at 55,841,600 bp
  • C to A, chromosome 12 at 71,312,777 bp
  • T to C, chromosome 12 at 72,223,524 bp
  • C to T, chromosome 12 at 72,885,218 bp
  • C to T, chromosome 12 at 76,329,924 bp
  • G to T, chromosome 12 at 76,604,012 bp
  • A to G, chromosome 12 at 80,722,321 bp
  • C to T, chromosome 12 at 84,325,720 bp
  • T to C, chromosome 12 at 85,267,141 bp
  • T to C, chromosome 12 at 104,476,600 bp
  • A to G, chromosome 13 at 4,575,178 bp
  • T to G, chromosome 13 at 13,661,161 bp
  • C to T, chromosome 13 at 74,190,065 bp
  • A to T, chromosome 13 at 89,688,483 bp
  • A to G, chromosome 14 at 21,847,330 bp
  • G to C, chromosome 14 at 55,073,944 bp
  • A to T, chromosome 14 at 60,244,670 bp
  • T to C, chromosome 14 at 103,227,511 bp
  • A to T, chromosome 15 at 10,451,563 bp
  • G to T, chromosome 15 at 58,192,258 bp
  • C to T, chromosome 15 at 99,149,940 bp
  • C to A, chromosome 15 at 100,955,528 bp
  • A to T, chromosome 16 at 17,295,376 bp
  • T to A, chromosome 16 at 18,821,173 bp
  • A to G, chromosome 16 at 21,221,745 bp
  • A to T, chromosome 16 at 22,806,675 bp
  • T to C, chromosome 16 at 23,613,120 bp
  • T to A, chromosome 16 at 32,614,625 bp
  • A to T, chromosome 16 at 36,495,591 bp
  • A to G, chromosome 16 at 38,827,135 bp
  • T to A, chromosome 16 at 87,950,068 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • A to G, chromosome 16 at 90,767,040 bp
  • A to G, chromosome 17 at 46,152,844 bp
  • G to C, chromosome 17 at 56,662,850 bp
  • A to G, chromosome 17 at 75,225,285 bp
  • A to G, chromosome 18 at 10,136,094 bp
  • C to A, chromosome 18 at 43,328,374 bp
  • T to A, chromosome 19 at 12,268,917 bp
  • A to G, chromosome 19 at 38,180,225 bp
  • A to G, chromosome 19 at 41,637,592 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1694 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039727-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.