MMRRC:039727-MU

A to T, chromosome 1 at 7,147,648 bp
C to G, chromosome 1 at 55,019,395 bp
C to T, chromosome 1 at 72,319,096 bp
C to T, chromosome 1 at 75,527,386 bp
A to T, chromosome 1 at 82,690,663 bp
T to C, chromosome 1 at 119,783,510 bp
A to C, chromosome 1 at 131,289,750 bp
C to T, chromosome 1 at 153,804,676 bp
A to T, chromosome 1 at 156,065,285 bp
T to C, chromosome 1 at 162,922,672 bp
A to G, chromosome 2 at 3,225,623 bp
A to G, chromosome 2 at 30,069,424 bp
A to G, chromosome 2 at 60,441,084 bp
A to T, chromosome 2 at 84,339,287 bp
A to G, chromosome 2 at 90,801,320 bp
A to T, chromosome 2 at 155,613,193 bp
A to G, chromosome 2 at 157,469,755 bp
A to G, chromosome 3 at 19,134,886 bp
A to C, chromosome 3 at 87,804,062 bp
A to G, chromosome 4 at 9,610,869 bp
A to G, chromosome 4 at 32,244,656 bp
G to T, chromosome 4 at 34,719,058 bp
G to T, chromosome 4 at 107,883,165 bp
A to G, chromosome 4 at 115,746,539 bp
A to G, chromosome 4 at 140,819,885 bp
T to A, chromosome 4 at 151,979,273 bp
A to G, chromosome 5 at 14,520,963 bp
A to G, chromosome 5 at 30,893,382 bp
G to C, chromosome 5 at 31,543,754 bp
A to G, chromosome 5 at 32,317,277 bp
A to G, chromosome 5 at 76,319,282 bp
A to G, chromosome 5 at 135,873,225 bp
A to G, chromosome 5 at 137,638,461 bp
A to G, chromosome 6 at 4,689,709 bp
T to C, chromosome 6 at 6,867,173 bp
A to G, chromosome 6 at 48,619,455 bp
A to C, chromosome 6 at 91,062,803 bp
A to C, chromosome 6 at 98,238,139 bp
A to T, chromosome 6 at 134,610,860 bp
T to A, chromosome 7 at 24,781,066 bp
T to A, chromosome 7 at 27,964,383 bp
C to A, chromosome 7 at 45,028,579 bp
C to A, chromosome 7 at 63,733,710 bp
A to G, chromosome 7 at 86,230,148 bp
A to T, chromosome 7 at 102,477,340 bp
A to G, chromosome 7 at 120,520,084 bp
G to A, chromosome 7 at 143,808,012 bp
T to C, chromosome 8 at 21,962,987 bp
G to A, chromosome 8 at 83,668,478 bp
T to A, chromosome 9 at 18,327,387 bp
C to A, chromosome 9 at 20,347,986 bp
A to T, chromosome 9 at 58,880,603 bp
A to G, chromosome 9 at 107,930,008 bp
A to G, chromosome 9 at 111,228,475 bp
A to T, chromosome 9 at 114,003,171 bp
T to C, chromosome 10 at 7,701,945 bp
T to C, chromosome 10 at 30,535,225 bp
T to C, chromosome 10 at 74,594,163 bp
T to A, chromosome 10 at 109,714,414 bp
T to C, chromosome 10 at 120,778,628 bp
T to A, chromosome 10 at 130,126,254 bp
CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
A to G, chromosome 11 at 23,281,399 bp
A to G, chromosome 11 at 50,207,480 bp
G to C, chromosome 11 at 52,374,363 bp
A to G, chromosome 11 at 65,053,197 bp
G to T, chromosome 11 at 65,954,824 bp
G to T, chromosome 11 at 70,793,792 bp
G to T, chromosome 11 at 70,978,247 bp
A to G, chromosome 11 at 71,216,855 bp
T to C, chromosome 11 at 101,532,099 bp
A to G, chromosome 12 at 51,744,592 bp
A to G, chromosome 12 at 55,841,600 bp
C to A, chromosome 12 at 71,312,777 bp
T to C, chromosome 12 at 72,223,524 bp
C to T, chromosome 12 at 72,885,218 bp
C to T, chromosome 12 at 76,329,924 bp
G to T, chromosome 12 at 76,604,012 bp
A to G, chromosome 12 at 80,722,321 bp
C to T, chromosome 12 at 84,325,720 bp
T to C, chromosome 12 at 85,267,141 bp
T to C, chromosome 12 at 104,476,600 bp
A to G, chromosome 13 at 4,575,178 bp
T to G, chromosome 13 at 13,661,161 bp
C to T, chromosome 13 at 74,190,065 bp
A to T, chromosome 13 at 89,688,483 bp
A to G, chromosome 14 at 21,847,330 bp
G to C, chromosome 14 at 55,073,944 bp
A to T, chromosome 14 at 60,244,670 bp
T to C, chromosome 14 at 103,227,511 bp
A to T, chromosome 15 at 10,451,563 bp
G to T, chromosome 15 at 58,192,258 bp
C to T, chromosome 15 at 99,149,940 bp
C to A, chromosome 15 at 100,955,528 bp
A to T, chromosome 16 at 17,295,376 bp
T to A, chromosome 16 at 18,821,173 bp
A to G, chromosome 16 at 21,221,745 bp
A to T, chromosome 16 at 22,806,675 bp
T to C, chromosome 16 at 23,613,120 bp
T to A, chromosome 16 at 32,614,625 bp
A to T, chromosome 16 at 36,495,591 bp
A to G, chromosome 16 at 38,827,135 bp
T to A, chromosome 16 at 87,950,068 bp
GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
A to G, chromosome 16 at 90,767,040 bp
A to G, chromosome 17 at 46,152,844 bp
G to C, chromosome 17 at 56,662,850 bp
A to G, chromosome 17 at 75,225,285 bp
A to G, chromosome 18 at 10,136,094 bp
C to A, chromosome 18 at 43,328,374 bp
T to A, chromosome 19 at 12,268,917 bp
A to G, chromosome 19 at 38,180,225 bp
A to G, chromosome 19 at 41,637,592 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R1694 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
039727-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All