Strain Name:
C57BL/6J-MtgxR1695Btlr/Mmmh
Stock Number:
039728-MU
Citation ID:
RRID:MMRRC_039728-MU
Other Names:
R1695 (G1), C57BL/6J-MtgxR1695Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320790
Homologene: 19067
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20742
Homologene: 2354
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Arfgef2
Name: ADP ribosylation factor guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99371
Homologene: 111880
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233765
Homologene: 52172
Adk
Name: adenosine kinase
Synonyms: AK, 5033405D03Rik, 2310026J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11534
VEGA: 14
HGNC: HGNC:257
Homologene: 4891
Tm9sf4
Name: transmembrane 9 superfamily member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99237
Homologene: 21620
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
L3mbtl2
Name: L3MBTL2 polycomb repressive complex 1 subunit
Synonyms: 4732493N06Rik, m4mbt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 214669
Homologene: 12882
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66185
Homologene: 41043
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94112
VEGA: 16
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ccm2
Name: cerebral cavernous malformation 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216527
Homologene: 12868
Arpc2
Name: actin related protein 2/3 complex, subunit 2
Synonyms: 2210023N03Rik, p34-Arc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 76709
HGNC: HGNC:705
Homologene: 4187
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Vim
Name: vimentin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22352
Homologene: 2538
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Unc119b
Name: unc-119 lipid binding chaperone B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 106840
Homologene: 43997
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20741
Homologene: 295
Reg4
Name: regenerating islet-derived family, member 4
Synonyms: RELP, 2010002L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67709
Homologene: 41671
Adgrf3
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381628
Homologene: 17826
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: LOC382045, PGR27, Gpr114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382045
Homologene: 17828
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73732
Homologene: 141193
Limk2
Name: LIM domain kinase 2
Synonyms: Limk2b, Limk2a, A930024P04Rik, LIM kinase 2, whe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16886
HGNC: HGNC:6614
Homologene: 55911
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-beta, IKK-2, IKK2, IKK[b], IKKbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170643
Homologene: 10089
Saal1
Name: serum amyloid A-like 1
Synonyms: 5031425D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78935
Homologene: 34706
Fgd2
Name: FYVE, RhoGEF and PH domain containing 2
Synonyms: tcs-2, Tcd-2, tcs2, Tcd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26382
HGNC: HGNC:3664
Homologene: 8438
Htr7
Name: 5-hydroxytryptamine (serotonin) receptor 7
Synonyms: 5-HT7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 15566
HGNC: HGNC:5302
Homologene: 20244
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Fhip2a
Name: FHF complex subunit HOOK interacting protein 2A
Synonyms: Fam160b1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226252
VEGA: 19
Homologene: 28133
Stk32a
Name: serine/threonine kinase 32A
Synonyms: YANK1, A930015B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 269019
VEGA: 18
Homologene: 65357
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211936
Homologene: 52235
Pabpc6
Name: poly(A) binding protein, cytoplasmic 6
Synonyms: 4932702K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 67543
VEGA: 17
HGNC: HGNC:8554
Homologene: 129776
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Trim44
Name: tripartite motif-containing 44
Synonyms: DIPB, Mc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 80985
Homologene: 9731
Hs2st1
Name: heparan sulfate 2-O-sulfotransferase 1
Synonyms: Hs2st
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23908
HGNC: HGNC:5193
Homologene: 8025
Il5ra
Name: interleukin 5 receptor, alpha
Synonyms: IL-5 receptor alpha chain, CD125, Il5r, CDw125
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16192
HGNC: HGNC:6017
Homologene: 473
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20274
Homologene: 2237
Eif3m
Name: eukaryotic translation initiation factor 3, subunit M
Synonyms: Pcid1, Ga17, Tango7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98221
Homologene: 4639
Nme1nme2
Name: NME/NM23 nucleoside diphosphate kinase 1 and 2 readthrough
Synonyms: Gm20390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Mprip
Name: myosin phosphatase Rho interacting protein
Synonyms: RIP3, p116Rip, p116 Rho interacting protein, Rhoip3, Gm34094
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 26936
Homologene: 9034
Vmn2r88
Name: vomeronasal 2, receptor 88
Synonyms: V2r13, V2r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 669149
Homologene: 129606
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Or2y13
Name: olfactory receptor family 2 subfamily Y member 14
Synonyms: GA_x6K02T2QP88-5912627-5911692, MOR256-56, Olfr1383
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 404337
Homologene: 105344
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171226
Homologene: 74320
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 57764
Homologene: 10934
Daglb
Name: diacylglycerol lipase, beta
Synonyms: E330036I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231871
Homologene: 34715
Ctsll3
Name: cathepsin L-like 3
Synonyms: 2310051M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 70202
VEGA: 13
HGNC: HGNC:2537
Homologene: 134916
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, BPFD#36, froggy, enr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Pex5l
Name: peroxisomal biogenesis factor 5-like
Synonyms: 1700016J08Rik, PXR2, TRIP8b, Pex2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 58869
Homologene: 9562
Cfap119
Name: cilia and flagella associated protein 119
Synonyms: LOC233899, Gm166, Ccdc189
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233899
Homologene: 79950
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, Snep, D430044C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Cfhr3
Name: complement factor H-related 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 624286
Homologene: 138664
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Kif4-ps
Name: kinesin family member 4, pseudogene
Synonyms: Kif4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74947
Or4p19
Name: olfactory receptor family 4 subfamily P member 19
Synonyms: GA_x6K02T2Q125-49900552-49899623, MOR225-1, Olfr1180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258920
Homologene: 74240
Synpo
Name: synaptopodin
Synonyms: 9330140I15Rik, 9030217H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104027
Homologene: 5274
Slc38a11
Name: solute carrier family 38, member 11
Synonyms: 9330158F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320106
Homologene: 5775
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320027
Homologene: 18543
Bpifa5
Name: BPI fold containing family A, member 5
Synonyms: 2310074B19Rik, 2310021H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67135
Homologene: 12087
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Appl2
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms: Dip3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216190
Homologene: 10046
Cfap418
Name: cilia and flagella associated protein 418
Synonyms: 2610301B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67157
Homologene: 18641
Ssna1
Name: SS nuclear autoantigen 1
Synonyms: 1190004J23Rik, 1110003H09Rik, NA14, N14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68475
Homologene: 2768
Vmn2r32
Name: vomeronasal 2, receptor 32
Synonyms: V2r5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22311
Homologene: 113703
Or51l4
Name: olfactory receptor family 51 subfamily L member 4
Synonyms: GA_x6K02T2PBJ9-6483085-6482126, MOR17-1, Olfr630
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259102
Homologene: 133674
Dusp6
Name: dual specificity phosphatase 6
Synonyms: 1300019I03Rik, MKP3, PYST1, MKP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67603
VEGA: 10
HGNC: HGNC:3072
Homologene: 55621
Cysltr2
Name: cysteinyl leukotriene receptor 2
Synonyms: CYSLT2R, Cyslt2, CysLT2, 2300001H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70086
VEGA: 14
Homologene: 10688
Syt15
Name: synaptotagmin XV
Synonyms: CHR10SYT, sytXV, E230025K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319508
Homologene: 12901
Il9r
Name: interleukin 9 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16199
HGNC: HGNC:6030
Homologene: 37591
Adam1b
Name: a disintegrin and metallopeptidase domain 1b
Synonyms: Ftna, PH-30 alpha, fertilin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 280667
Homologene: 136485
Ferd3l
Name: Fer3 like bHLH transcription factor
Synonyms: fer3, Mnato3, N-twist, Nato3, bHLHa31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 114712
VEGA: 12
Homologene: 14136
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 54,417,778 bp
  • TCACACACACACACACACACACACACACA to TCACACACACACACACACACACACACACACA, chromosome 1 at 68,331,177 bp
  • T to A, chromosome 1 at 74,248,232 bp
  • G to A, chromosome 1 at 93,281,654 bp
  • A to G, chromosome 1 at 93,437,200 bp
  • T to A, chromosome 1 at 93,560,325 bp
  • A to G, chromosome 1 at 139,593,888 bp
  • T to C, chromosome 1 at 140,102,837 bp
  • T to A, chromosome 2 at 13,580,110 bp
  • C to A, chromosome 2 at 25,272,012 bp
  • T to A, chromosome 2 at 65,316,971 bp
  • C to T, chromosome 2 at 66,504,876 bp
  • T to C, chromosome 2 at 88,412,100 bp
  • T to C, chromosome 2 at 102,357,485 bp
  • A to T, chromosome 2 at 104,992,105 bp
  • T to C, chromosome 2 at 105,016,953 bp
  • A to G, chromosome 2 at 153,190,912 bp
  • T to C, chromosome 2 at 154,167,660 bp
  • T to C, chromosome 2 at 166,864,712 bp
  • T to A, chromosome 3 at 32,954,382 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • C to T, chromosome 3 at 98,236,361 bp
  • G to T, chromosome 3 at 144,434,654 bp
  • T to A, chromosome 4 at 8,833,960 bp
  • T to A, chromosome 4 at 10,874,644 bp
  • T to A, chromosome 4 at 11,494,814 bp
  • T to C, chromosome 4 at 141,306,517 bp
  • T to A, chromosome 4 at 148,538,907 bp
  • T to A, chromosome 5 at 30,203,555 bp
  • T to A, chromosome 5 at 115,134,826 bp
  • T to A, chromosome 5 at 121,500,907 bp
  • T to C, chromosome 5 at 143,494,606 bp
  • T to A, chromosome 6 at 82,744,951 bp
  • A to T, chromosome 6 at 106,738,374 bp
  • T to A, chromosome 7 at 7,463,992 bp
  • T to C, chromosome 7 at 46,692,916 bp
  • A to G, chromosome 7 at 88,036,103 bp
  • GCG to GCGACG, chromosome 7 at 97,579,907 bp
  • A to C, chromosome 7 at 98,092,496 bp
  • A to T, chromosome 7 at 103,754,924 bp
  • T to C, chromosome 7 at 116,128,685 bp
  • A to G, chromosome 7 at 127,587,573 bp
  • C to G, chromosome 8 at 22,120,878 bp
  • T to A, chromosome 8 at 22,673,480 bp
  • A to G, chromosome 8 at 27,393,700 bp
  • A to T, chromosome 8 at 72,818,082 bp
  • T to G, chromosome 8 at 91,001,782 bp
  • A to G, chromosome 8 at 94,937,745 bp
  • C to G, chromosome 8 at 122,862,016 bp
  • A to G, chromosome 9 at 18,497,433 bp
  • G to T, chromosome 9 at 67,972,075 bp
  • A to T, chromosome 9 at 119,337,842 bp
  • G to T, chromosome 10 at 39,824,615 bp
  • A to T, chromosome 10 at 39,824,616 bp
  • C to T, chromosome 10 at 83,621,582 bp
  • T to A, chromosome 10 at 93,733,602 bp
  • T to A, chromosome 10 at 99,263,693 bp
  • T to G, chromosome 10 at 107,814,017 bp
  • A to G, chromosome 11 at 3,353,275 bp
  • A to G, chromosome 11 at 6,593,137 bp
  • T to C, chromosome 11 at 30,136,124 bp
  • T to A, chromosome 11 at 32,193,227 bp
  • T to C, chromosome 11 at 49,524,335 bp
  • T to A, chromosome 11 at 53,165,878 bp
  • C to T, chromosome 11 at 59,752,531 bp
  • T to A, chromosome 11 at 69,514,691 bp
  • C to A, chromosome 11 at 86,701,060 bp
  • A to C, chromosome 11 at 93,960,767 bp
  • G to T, chromosome 11 at 101,524,455 bp
  • C to A, chromosome 12 at 33,928,972 bp
  • C to A, chromosome 12 at 76,620,867 bp
  • C to G, chromosome 12 at 101,147,939 bp
  • A to G, chromosome 13 at 55,476,708 bp
  • T to A, chromosome 13 at 60,800,977 bp
  • A to G, chromosome 14 at 21,381,600 bp
  • T to C, chromosome 14 at 30,891,499 bp
  • T to A, chromosome 14 at 31,707,244 bp
  • C to T, chromosome 14 at 34,222,901 bp
  • C to T, chromosome 14 at 51,416,702 bp
  • T to C, chromosome 14 at 73,029,881 bp
  • T to C, chromosome 15 at 35,576,521 bp
  • A to G, chromosome 15 at 81,684,392 bp
  • A to G, chromosome 16 at 17,722,780 bp
  • G to A, chromosome 17 at 9,668,074 bp
  • A to T, chromosome 17 at 20,776,298 bp
  • A to T, chromosome 17 at 29,368,245 bp
  • C to T, chromosome 18 at 38,202,868 bp
  • G to T, chromosome 18 at 43,313,420 bp
  • A to G, chromosome 18 at 60,603,387 bp
  • T to C, chromosome 19 at 35,969,736 bp
  • T to C, chromosome 19 at 57,379,171 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1695 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039728-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.