Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1695Btlr/Mmmh
Stock Number:
039728-MU
Citation ID:
RRID:MMRRC_039728-MU
Other Names:
R1695 (G1), C57BL/6J-MtgxR1695Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 54,417,778 bp
  • TCACACACACACACACACACACACACACA to TCACACACACACACACACACACACACACACA, chromosome 1 at 68,331,177 bp
  • T to A, chromosome 1 at 74,248,232 bp
  • G to A, chromosome 1 at 93,281,654 bp
  • A to G, chromosome 1 at 93,437,200 bp
  • T to A, chromosome 1 at 93,560,325 bp
  • A to G, chromosome 1 at 139,593,888 bp
  • T to C, chromosome 1 at 140,102,837 bp
  • T to A, chromosome 2 at 13,580,110 bp
  • C to A, chromosome 2 at 25,272,012 bp
  • T to A, chromosome 2 at 65,316,971 bp
  • C to T, chromosome 2 at 66,504,876 bp
  • T to C, chromosome 2 at 88,412,100 bp
  • T to C, chromosome 2 at 102,357,485 bp
  • A to T, chromosome 2 at 104,992,105 bp
  • T to C, chromosome 2 at 105,016,953 bp
  • A to G, chromosome 2 at 153,190,912 bp
  • T to C, chromosome 2 at 154,167,660 bp
  • T to C, chromosome 2 at 166,864,712 bp
  • T to A, chromosome 3 at 32,954,382 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • C to T, chromosome 3 at 98,236,361 bp
  • G to T, chromosome 3 at 144,434,654 bp
  • T to A, chromosome 4 at 8,833,960 bp
  • T to A, chromosome 4 at 10,874,644 bp
  • T to A, chromosome 4 at 11,494,814 bp
  • T to C, chromosome 4 at 141,306,517 bp
  • T to A, chromosome 4 at 148,538,907 bp
  • T to A, chromosome 5 at 30,203,555 bp
  • T to A, chromosome 5 at 115,134,826 bp
  • T to A, chromosome 5 at 121,500,907 bp
  • T to C, chromosome 5 at 143,494,606 bp
  • T to A, chromosome 6 at 82,744,951 bp
  • A to T, chromosome 6 at 106,738,374 bp
  • T to A, chromosome 7 at 7,463,992 bp
  • T to C, chromosome 7 at 46,692,916 bp
  • A to G, chromosome 7 at 88,036,103 bp
  • GCG to GCGACG, chromosome 7 at 97,579,907 bp
  • A to C, chromosome 7 at 98,092,496 bp
  • A to T, chromosome 7 at 103,754,924 bp
  • T to C, chromosome 7 at 116,128,685 bp
  • A to G, chromosome 7 at 127,587,573 bp
  • C to G, chromosome 8 at 22,120,878 bp
  • T to A, chromosome 8 at 22,673,480 bp
  • A to G, chromosome 8 at 27,393,700 bp
  • A to T, chromosome 8 at 72,818,082 bp
  • T to G, chromosome 8 at 91,001,782 bp
  • A to G, chromosome 8 at 94,937,745 bp
  • C to G, chromosome 8 at 122,862,016 bp
  • A to G, chromosome 9 at 18,497,433 bp
  • G to T, chromosome 9 at 67,972,075 bp
  • A to T, chromosome 9 at 119,337,842 bp
  • G to T, chromosome 10 at 39,824,615 bp
  • A to T, chromosome 10 at 39,824,616 bp
  • C to T, chromosome 10 at 83,621,582 bp
  • T to A, chromosome 10 at 93,733,602 bp
  • T to A, chromosome 10 at 99,263,693 bp
  • T to G, chromosome 10 at 107,814,017 bp
  • A to G, chromosome 11 at 3,353,275 bp
  • A to G, chromosome 11 at 6,593,137 bp
  • T to C, chromosome 11 at 30,136,124 bp
  • T to A, chromosome 11 at 32,193,227 bp
  • T to C, chromosome 11 at 49,524,335 bp
  • T to A, chromosome 11 at 53,165,878 bp
  • C to T, chromosome 11 at 59,752,531 bp
  • T to A, chromosome 11 at 69,514,691 bp
  • C to A, chromosome 11 at 86,701,060 bp
  • A to C, chromosome 11 at 93,960,767 bp
  • G to T, chromosome 11 at 101,524,455 bp
  • C to A, chromosome 12 at 33,928,972 bp
  • C to A, chromosome 12 at 76,620,867 bp
  • C to G, chromosome 12 at 101,147,939 bp
  • A to G, chromosome 13 at 55,476,708 bp
  • T to A, chromosome 13 at 60,800,977 bp
  • A to G, chromosome 14 at 21,381,600 bp
  • T to C, chromosome 14 at 30,891,499 bp
  • T to A, chromosome 14 at 31,707,244 bp
  • C to T, chromosome 14 at 34,222,901 bp
  • C to T, chromosome 14 at 51,416,702 bp
  • T to C, chromosome 14 at 73,029,881 bp
  • T to C, chromosome 15 at 35,576,521 bp
  • A to G, chromosome 15 at 81,684,392 bp
  • A to G, chromosome 16 at 17,722,780 bp
  • G to A, chromosome 17 at 9,668,074 bp
  • A to T, chromosome 17 at 20,776,298 bp
  • A to T, chromosome 17 at 29,368,245 bp
  • C to T, chromosome 18 at 38,202,868 bp
  • G to T, chromosome 18 at 43,313,420 bp
  • A to G, chromosome 18 at 60,603,387 bp
  • T to C, chromosome 19 at 35,969,736 bp
  • T to C, chromosome 19 at 57,379,171 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1695 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039728-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.