Strain Name:
C57BL/6J-MtgxR1875Btlr/Mmmh
Stock Number:
039897-MU
Citation ID:
RRID:MMRRC_039897-MU
Other Names:
R1875 (G1), C57BL/6J-MtgxR1875Btlr
Major Collection:

Strain Information

Adamts20
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Myk2, Sek2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: prestin, Pres
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Ndr1, DRG1, Tdd5, TDD5, CAP43, CMT4D, Ndrl, PROXY1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Zfp809
Name: zinc finger protein 809
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235047
VEGA: 9
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245944
Homologene: 5605
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b1863Clo, b2b553Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Rad51c
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 114714
HGNC: HGNC:9820
Homologene: 14238
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Synj2
Name: synaptojanin 2
Synonyms: SJ2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20975
Homologene: 117703
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320365
Homologene: 113770
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194401
Homologene: 85288
Zfp106
Name: zinc finger protein 106
Synonyms: Sh3bp3, H3a, Cd-1, sirm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20402
Homologene: 40787
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50781
HGNC: HGNC:2893
Homologene: 8303
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 277939
Homologene: 19524
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7a, Dnahc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: 8430412F05Rik, C330002G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242860
Homologene: 19435
Fbxl18
Name: F-box and leucine-rich repeat protein 18
Synonyms: B130019G13Rik, C330021B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231863
Homologene: 41603
Gpr68
Name: G protein-coupled receptor 68
Synonyms: OGR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238377
HGNC: HGNC:4519
Homologene: 2603
Serpina3c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3C
Synonyms: Kalbp, Klkbp, 1A1, alpha-1 antiproteinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16625
HGNC: HGNC:16
Homologene: 111129
Jup
Name: junction plakoglobin
Synonyms: PG, gamma-catenin, D930025P04Rik, Ctnng, plakoglobin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: HER3, Erbb3r, Erbb-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Htt
Name: huntingtin
Synonyms: C430023I11Rik, huntingtin, HD, Hdh, htt, IT15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Ddx21
Name: DExD box helicase 21
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 21, RH II/Gu, D10Ertd645e, D10Wsu42e, RH-II/Gualpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56200
VEGA: 10
HGNC: HGNC:2744
Homologene: 3473
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232339
Homologene: 45968
Timm21
Name: translocase of inner mitochondrial membrane 21
Synonyms: 1700034H14Rik, 2700002I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67105
VEGA: 18
Homologene: 32211
Zfp668
Name: zinc finger protein 668
Synonyms: E130018B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244219
Homologene: 11667
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229473
Homologene: 9057
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67419
Homologene: 12127
Kifc5b
Name: kinesin family member C5B
Synonyms: kinesin family c-terminal 5B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16580
VEGA: 17
HGNC: HGNC:6389
Homologene: 83229
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Fli1
Name: Friend leukemia integration 1
Synonyms: Sic1, Fli-1, EWSR2, SIC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14247
HGNC: HGNC:3749
Homologene: 55624
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Tmem86b
Name: transmembrane protein 86B
Synonyms: C330014O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68255
Homologene: 52159
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58178
Homologene: 10967
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 213435
Homologene: 35278
Elmod1
Name: ELMO/CED-12 domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270162
VEGA: 9
Homologene: 10280
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76295
Homologene: 32919
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Arhgef38
Name: Rho guanine nucleotide exchange factor (GEF) 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 77669
Homologene: 137396
Parp10
Name: poly (ADP-ribose) polymerase family, member 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 671535
Homologene: 53133
Or2b4
Name: olfactory receptor family 2 subfamily B member 4
Synonyms: MOR256-3, SR1, Olfr124, A3, GA_x6K02T2PSCP-2264806-2265753
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 259064
Homologene: 74266
Krba1
Name: KRAB-A domain containing 1
Synonyms: A930040G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 77827
Homologene: 15880
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73173
Homologene: 10389
Tigd4
Name: tigger transposable element derived 4
Synonyms: Tigd4, C130063O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 403175
Homologene: 131124
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71774
Homologene: 12411
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Or6b6
Name: olfactory receptor family 6 subfamily B member 6
Synonyms: Olfr711, MOR103-4, GA_x6K02T2PBJ9-9352783-9351839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259037
Homologene: 128111
Tmem106a
Name: transmembrane protein 106A
Synonyms: 0610008L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217203
Homologene: 16996
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320277
Homologene: 23371
Cfap52
Name: cilia and flagella associated protein 52
Synonyms: Wdr16, 4933417B11Rik, 1700019F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71860
Homologene: 12416
Lamp1
Name: lysosomal-associated membrane protein 1
Synonyms: Perk, CD107a, Lamp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16783
HGNC: HGNC:6499
Homologene: 4061
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67928
Homologene: 86128
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: flamingo, Adgrc3, Fmi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Cdh2
Name: cadherin 2
Synonyms: N-cadherin, N-CAD, Ncad
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12558
HGNC: HGNC:1759
Homologene: 20424
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56868
Homologene: 110989
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, Plcl4, A930027K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269615
Homologene: 85172
Pnliprp2
Name: pancreatic lipase-related protein 2
Synonyms: PLRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18947
VEGA: 19
HGNC: HGNC:9157
Homologene: 3936
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: Mamdc3, 1200011I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74762
Homologene: 17780
Adam26a
Name: a disintegrin and metallopeptidase domain 26A (testase 3)
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13525
Homologene: 128363
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl-I, thrombopoietin receptor, c-mpl, c-mpl-II, hlb219, TPO-R, CD110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Spmap2l
Name: sperm microtubule associated protein 2 like
Synonyms: Thegl, 1700023E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71868
Homologene: 128474
Lrrc17
Name: leucine rich repeat containing 17
Synonyms: 4833425M04Rik, 6130400C22Rik, 37kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74511
Homologene: 55929
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Cimap2
Name: ciliary microtubule associated protein 2
Synonyms: BC055111, Lexm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242602
Homologene: 17630
Pigc
Name: phosphatidylinositol glycan anchor biosynthesis, class C
Synonyms: 3110030E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67292
HGNC: HGNC:8960
Homologene: 7109
Slc41a2
Name: solute carrier family 41, member 2
Synonyms: A230035L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 338365
Homologene: 9870
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226356
Homologene: 88578
Abi3bp
Name: ABI family member 3 binding protein
Synonyms: D930038M13Rik, TARSH, eratin, 5033411B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Mterf1b
Name: mitochondrial transcription termination factor 1b
Synonyms: Gm9897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208595
Homologene: 5073
Btnl10
Name: butyrophilin-like 10
Synonyms: Butr1, BUTR-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192194
Homologene: 138184
Neil3
Name: nei like 3 (E. coli)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234258
Homologene: 10094
Gm8258
Name: predicted gene 8258
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 666726
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: D/tPRP, mdPRP, Dtprp, DPRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13529
HGNC: HGNC:9445
Homologene: 49230
Fmo4
Name: flavin containing monooxygenase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226564
HGNC: HGNC:3772
Homologene: 68219
Snx31
Name: sorting nexin 31
Synonyms: 4631426E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66696
Homologene: 23551
Ddah2
Name: dimethylarginine dimethylaminohydrolase 2
Synonyms: Ddah, Clone 7u, G6a, NG30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 51793
HGNC: HGNC:2716
Homologene: 8510
Apol11a
Name: apolipoprotein L 11a
Synonyms: EG626615
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 626615
VEGA: 15
Homologene: 129975
Myoz2
Name: myozenin 2
Synonyms: calsarcin-1, 1110012I24Rik, Fatz-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 59006
HGNC: HGNC:1330
Homologene: 9583
Pars2
Name: prolyl-tRNA synthetase (mitochondrial)(putative)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230577
Homologene: 5830
Gm10477
Name: predicted gene 10477
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Homologene: 141188
Slc37a4
Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4
Synonyms: G6pt1, G6PT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14385
VEGA: 9
HGNC: HGNC:4061
Homologene: 37482
Tspan13
Name: tetraspanin 13
Synonyms: 1100001I23Rik, Tm4sf13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66109
Homologene: 8671
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 30,830,623 bp
  • A to T, chromosome 1 at 53,456,532 bp
  • T to C, chromosome 1 at 75,498,233 bp
  • T to C, chromosome 1 at 119,953,659 bp
  • A to G, chromosome 1 at 161,970,947 bp
  • T to C, chromosome 1 at 162,803,618 bp
  • A to T, chromosome 2 at 120,513,615 bp
  • T to C, chromosome 3 at 35,839,147 bp
  • A to T, chromosome 3 at 49,754,705 bp
  • A to T, chromosome 3 at 83,905,076 bp
  • A to C, chromosome 3 at 84,595,087 bp
  • A to T, chromosome 3 at 123,026,116 bp
  • T to A, chromosome 3 at 133,133,740 bp
  • G to A, chromosome 4 at 106,613,256 bp
  • T to C, chromosome 4 at 106,653,716 bp
  • A to G, chromosome 4 at 118,456,829 bp
  • A to G, chromosome 4 at 141,308,979 bp
  • G to A, chromosome 4 at 154,998,508 bp
  • T to A, chromosome 5 at 4,197,364 bp
  • C to T, chromosome 5 at 20,951,698 bp
  • C to T, chromosome 5 at 21,560,652 bp
  • T to A, chromosome 5 at 21,815,727 bp
  • T to A, chromosome 5 at 34,794,112 bp
  • A to T, chromosome 5 at 77,054,584 bp
  • A to G, chromosome 5 at 104,776,454 bp
  • G to A, chromosome 5 at 142,886,223 bp
  • A to G, chromosome 5 at 150,326,132 bp
  • T to A, chromosome 6 at 48,414,049 bp
  • G to T, chromosome 6 at 115,978,084 bp
  • A to G, chromosome 6 at 118,540,449 bp
  • A to T, chromosome 6 at 121,042,064 bp
  • A to T, chromosome 7 at 4,629,699 bp
  • G to A, chromosome 7 at 18,610,450 bp
  • A to G, chromosome 7 at 100,407,025 bp
  • G to A, chromosome 7 at 106,972,182 bp
  • A to G, chromosome 7 at 112,149,055 bp
  • A to T, chromosome 7 at 116,417,971 bp
  • A to T, chromosome 7 at 120,247,967 bp
  • T to C, chromosome 7 at 127,866,482 bp
  • G to A, chromosome 8 at 13,167,257 bp
  • T to C, chromosome 8 at 15,929,101 bp
  • C to A, chromosome 8 at 43,569,851 bp
  • G to T, chromosome 8 at 53,599,419 bp
  • A to G, chromosome 8 at 85,352,865 bp
  • A to T, chromosome 9 at 22,238,731 bp
  • T to C, chromosome 9 at 32,423,913 bp
  • A to G, chromosome 9 at 44,401,511 bp
  • A to G, chromosome 9 at 53,935,867 bp
  • T to C, chromosome 9 at 108,835,838 bp
  • A to G, chromosome 10 at 62,594,068 bp
  • A to G, chromosome 10 at 83,256,085 bp
  • T to C, chromosome 10 at 107,899,590 bp
  • T to C, chromosome 10 at 128,574,466 bp
  • A to G, chromosome 11 at 8,844,670 bp
  • A to G, chromosome 11 at 21,300,251 bp
  • A to G, chromosome 11 at 53,465,675 bp
  • T to A, chromosome 11 at 58,923,760 bp
  • C to T, chromosome 11 at 60,507,528 bp
  • A to G, chromosome 11 at 67,953,630 bp
  • A to T, chromosome 11 at 87,388,643 bp
  • A to G, chromosome 11 at 100,372,294 bp
  • CAGCTCAACACGACGGTA to CAGCTCAACACGACGGTAAGCTCAACACGACGGTA, chromosome 11 at 101,586,378 bp
  • T to C, chromosome 12 at 36,020,551 bp
  • T to A, chromosome 12 at 100,878,790 bp
  • C to A, chromosome 12 at 104,151,886 bp
  • T to C, chromosome 13 at 27,351,054 bp
  • T to C, chromosome 14 at 49,682,358 bp
  • C to T, chromosome 15 at 9,584,108 bp
  • C to T, chromosome 15 at 9,597,401 bp
  • T to C, chromosome 15 at 36,546,768 bp
  • T to C, chromosome 15 at 66,931,091 bp
  • T to C, chromosome 15 at 76,242,851 bp
  • C to A, chromosome 15 at 77,513,566 bp
  • G to T, chromosome 15 at 94,331,396 bp
  • A to G, chromosome 16 at 56,574,499 bp
  • G to T, chromosome 17 at 6,028,550 bp
  • G to A, chromosome 17 at 26,917,290 bp
  • T to C, chromosome 17 at 29,852,607 bp
  • T to C, chromosome 17 at 30,959,119 bp
  • T to C, chromosome 17 at 35,060,845 bp
  • A to G, chromosome 17 at 37,805,105 bp
  • T to A, chromosome 18 at 16,624,877 bp
  • G to C, chromosome 18 at 84,949,262 bp
  • G to A, chromosome 19 at 50,288,074 bp
  • G to T, chromosome 19 at 58,763,389 bp
  • T to A, chromosome X at 56,524,767 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1875 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.