Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1875Btlr/Mmmh
Stock Number:
039897-MU
Citation ID:
RRID:MMRRC_039897-MU
Other Names:
R1875 (G1), C57BL/6J-MtgxR1875Btlr
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 30,830,623 bp
  • A to T, chromosome 1 at 53,456,532 bp
  • T to C, chromosome 1 at 75,498,233 bp
  • T to C, chromosome 1 at 119,953,659 bp
  • A to G, chromosome 1 at 161,970,947 bp
  • T to C, chromosome 1 at 162,803,618 bp
  • A to T, chromosome 2 at 120,513,615 bp
  • T to C, chromosome 3 at 35,839,147 bp
  • A to T, chromosome 3 at 49,754,705 bp
  • A to T, chromosome 3 at 83,905,076 bp
  • A to C, chromosome 3 at 84,595,087 bp
  • A to T, chromosome 3 at 123,026,116 bp
  • T to A, chromosome 3 at 133,133,740 bp
  • G to A, chromosome 4 at 106,613,256 bp
  • T to C, chromosome 4 at 106,653,716 bp
  • A to G, chromosome 4 at 118,456,829 bp
  • A to G, chromosome 4 at 141,308,979 bp
  • G to A, chromosome 4 at 154,998,508 bp
  • T to A, chromosome 5 at 4,197,364 bp
  • C to T, chromosome 5 at 20,951,698 bp
  • C to T, chromosome 5 at 21,560,652 bp
  • T to A, chromosome 5 at 21,815,727 bp
  • T to A, chromosome 5 at 34,794,112 bp
  • A to T, chromosome 5 at 77,054,584 bp
  • A to G, chromosome 5 at 104,776,454 bp
  • G to A, chromosome 5 at 142,886,223 bp
  • A to G, chromosome 5 at 150,326,132 bp
  • T to A, chromosome 6 at 48,414,049 bp
  • G to T, chromosome 6 at 115,978,084 bp
  • A to G, chromosome 6 at 118,540,449 bp
  • A to T, chromosome 6 at 121,042,064 bp
  • A to T, chromosome 7 at 4,629,699 bp
  • G to A, chromosome 7 at 18,610,450 bp
  • A to G, chromosome 7 at 100,407,025 bp
  • G to A, chromosome 7 at 106,972,182 bp
  • A to G, chromosome 7 at 112,149,055 bp
  • A to T, chromosome 7 at 116,417,971 bp
  • A to T, chromosome 7 at 120,247,967 bp
  • T to C, chromosome 7 at 127,866,482 bp
  • G to A, chromosome 8 at 13,167,257 bp
  • T to C, chromosome 8 at 15,929,101 bp
  • C to A, chromosome 8 at 43,569,851 bp
  • G to T, chromosome 8 at 53,599,419 bp
  • A to G, chromosome 8 at 85,352,865 bp
  • A to T, chromosome 9 at 22,238,731 bp
  • T to C, chromosome 9 at 32,423,913 bp
  • A to G, chromosome 9 at 44,401,511 bp
  • A to G, chromosome 9 at 53,935,867 bp
  • T to C, chromosome 9 at 108,835,838 bp
  • A to G, chromosome 10 at 62,594,068 bp
  • A to G, chromosome 10 at 83,256,085 bp
  • T to C, chromosome 10 at 107,899,590 bp
  • T to C, chromosome 10 at 128,574,466 bp
  • A to G, chromosome 11 at 8,844,670 bp
  • A to G, chromosome 11 at 21,300,251 bp
  • A to G, chromosome 11 at 53,465,675 bp
  • T to A, chromosome 11 at 58,923,760 bp
  • C to T, chromosome 11 at 60,507,528 bp
  • A to G, chromosome 11 at 67,953,630 bp
  • A to T, chromosome 11 at 87,388,643 bp
  • A to G, chromosome 11 at 100,372,294 bp
  • CAGCTCAACACGACGGTA to CAGCTCAACACGACGGTAAGCTCAACACGACGGTA, chromosome 11 at 101,586,378 bp
  • T to C, chromosome 12 at 36,020,551 bp
  • T to A, chromosome 12 at 100,878,790 bp
  • C to A, chromosome 12 at 104,151,886 bp
  • T to C, chromosome 13 at 27,351,054 bp
  • T to C, chromosome 14 at 49,682,358 bp
  • C to T, chromosome 15 at 9,584,108 bp
  • C to T, chromosome 15 at 9,597,401 bp
  • T to C, chromosome 15 at 36,546,768 bp
  • T to C, chromosome 15 at 66,931,091 bp
  • T to C, chromosome 15 at 76,242,851 bp
  • C to A, chromosome 15 at 77,513,566 bp
  • G to T, chromosome 15 at 94,331,396 bp
  • A to G, chromosome 16 at 56,574,499 bp
  • G to T, chromosome 17 at 6,028,550 bp
  • G to A, chromosome 17 at 26,917,290 bp
  • T to C, chromosome 17 at 29,852,607 bp
  • T to C, chromosome 17 at 30,959,119 bp
  • T to C, chromosome 17 at 35,060,845 bp
  • A to G, chromosome 17 at 37,805,105 bp
  • T to A, chromosome 18 at 16,624,877 bp
  • G to C, chromosome 18 at 84,949,262 bp
  • G to A, chromosome 19 at 50,288,074 bp
  • G to T, chromosome 19 at 58,763,389 bp
  • T to A, chromosome X at 56,524,767 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1875 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.