Strain Name:
C57BL/6J-MtgxR1889Btlr/Mmmh
Stock Number:
039910-MU
Citation ID:
RRID:MMRRC_039910-MU
Other Names:
R1889 (G1), C57BL/6J-MtgxR1889Btlr
Major Collection:

Strain Information

Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 104245
Homologene: 37901
Lcor
Name: ligand dependent nuclear receptor corepressor
Synonyms: 3110023F06Rik, Mlr2, A630025C20Rik, LOC381224, Gm340
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 212391
VEGA: 19
Homologene: 18153
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: NBL5, 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226352
Homologene: 32492
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 380993
Homologene: 16829
Dnmt3b
Name: DNA methyltransferase 3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13436
HGNC: HGNC:2979
Homologene: 56000
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Ilf3
Name: interleukin enhancer binding factor 3
Synonyms: NF90
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16201
VEGA: 9
HGNC: HGNC:6038
Homologene: 7785
Nup98
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269966
HGNC: HGNC:8068
Homologene: 35472
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, rjs, D7H15F37S1, jdf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228421
Homologene: 41820
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: 2610528A15Rik, Skiv2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Itgb2
Name: integrin beta 2
Synonyms: Mac-1 beta, 2E6, Cd18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16414
HGNC: HGNC:6155
Homologene: 20092
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, Tacc1, B230378H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320165
Homologene: 4575
Anapc7
Name: anaphase promoting complex subunit 7
Synonyms: prediabetic NOD sera-reactive autoantigen, APC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56317
Homologene: 10512
Rbck1
Name: RanBP-type and C3HC4-type zinc finger containing 1
Synonyms: Ubce7ip3, HOIL-1L, HOIL-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 24105
Homologene: 32448
Ift122
Name: intraflagellar transport 122
Synonyms: C86139, Wdr10, sopb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 81896
Homologene: 12819
Rtn1
Name: reticulon 1
Synonyms: Nsp, Rtn1-b, Rtn1-c, 0710005K15Rik, Rtn1-a, 4930441F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104001
Homologene: 49654
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233878
Homologene: 8237
Aco1
Name: aconitase 1
Synonyms: Irp1, Irebp, Aco-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11428
HGNC: HGNC:117
Homologene: 1657
Slc10a4
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231290
Homologene: 15495
Acp6
Name: acid phosphatase 6, lysophosphatidic
Synonyms: 5730559A09Rik, mPACPL1, ACPL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66659
Homologene: 41128
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: 1700108N18Rik, E430013J17Rik, 6330500D04Rik, Fam65b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 193385
Homologene: 9284
Gkn2
Name: gastrokine 2
Synonyms: 1810036H07Rik, Bricd1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66284
Homologene: 11942
Cnpy4
Name: canopy FGF signaling regulator 4
Synonyms: 2610019P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 66455
Homologene: 15196
Nxpe2
Name: neurexophilin and PC-esterase domain family, member 2
Synonyms: 4432416J03Rik, Fam55b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78252
Homologene: 87072
Fchsd1
Name: FCH and double SH3 domains 1
Synonyms: A030002D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 319262
Homologene: 14127
Kif7
Name: kinesin family member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16576
Homologene: 72555
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 104401
Homologene: 17000
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72993
Homologene: 32143
Phlpp1
Name: PH domain and leucine rich repeat protein phosphatase 1
Synonyms: Plekhe1, Phlpp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98432
Homologene: 11015
Marchf6
Name: membrane associated ring-CH-type finger 6
Synonyms: F830029L24Rik, March6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223455
VEGA: 15
Homologene: 4301
Klhl26
Name: kelch-like 26
Synonyms: C630013N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234378
Homologene: 41247
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237860
Homologene: 14116
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319675
Homologene: 27936
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP-76, twm, SLP76, m1Khoe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fam20a
Name: FAM20A, golgi associated secretory pathway pseudokinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 208659
Homologene: 9719
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244071
Homologene: 17552
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Cdt1
Name: chromatin licensing and DNA replication factor 1
Synonyms: 2610318F11Rik, Ris2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67177
Homologene: 32650
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
V1rd19
Name: vomeronasal 1 receptor, D19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404287
Homologene: 104166
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Trpm5
Name: transient receptor potential cation channel, subfamily M, member 5
Synonyms: Mtr1, Ltrpc5, 9430099A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56843
Homologene: 22818
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 1700086G18Rik, 4930511O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75083
Homologene: 75281
Fbxo44
Name: F-box protein 44
Synonyms: Fbx6a, FBX30, FBG3, Fbxo6a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230903
Homologene: 13232
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81877
Homologene: 49589
Sema3d
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms: 4631426B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108151
Homologene: 23664
Cadm2
Name: cell adhesion molecule 2
Synonyms: A830029E02Rik, Necl3, SynCAM2, Igsf4d, 2900078E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239857
Homologene: 17705
Dpp7
Name: dipeptidylpeptidase 7
Synonyms: QPP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 83768
Homologene: 22748
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210274
Homologene: 105965
Ccdc81
Name: coiled-coil domain containing 81
Synonyms: 4921513D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70884
Homologene: 128447
Rnf139
Name: ring finger protein 139
Synonyms: 4930555P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75841
VEGA: 15
Homologene: 5222
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319807
Homologene: 14974
Gtdc1
Name: glycosyltransferase-like domain containing 1
Synonyms: E330008O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227835
Homologene: 32590
Engase
Name: endo-beta-N-acetylglucosaminidase
Synonyms: D230014K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217364
Homologene: 13666
H2-Q2
Name: histocompatibility 2, Q region locus 2
Synonyms: H-2Q2, Gm11132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15013
Homologene: 128352
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, D4Ertd800e, Ncoa6ip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 116940
Homologene: 32608
Dpm1
Name: dolichyl-phosphate mannosyltransferase subunit 1, catalytic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13480
HGNC: HGNC:3005
Homologene: 2865
Cenpj
Name: centromere protein J
Synonyms: 4932437H03Rik, Sas4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219103
Homologene: 10204
Herc6
Name: hect domain and RLD 6
Synonyms: 4930427L17Rik, 1700121D12Rik, CEB1, 2510038N07Rik, Herc5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67138
Homologene: 70768
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Nipal4
Name: NIPA-like domain containing 4
Synonyms: 9530066K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 214112
Homologene: 133769
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56430
Homologene: 74455
Or5ac22
Name: olfactory receptor family 5 subfamily AC member 22
Synonyms: GA_x54KRFPKG5P-55529713-55528796, MOR182-3, Olfr204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258994
Homologene: 79425
Arhgef19
Name: Rho guanine nucleotide exchange factor 19
Synonyms: 6430573B13Rik, WGEF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 213649
Homologene: 17710
Ap1g2
Name: adaptor protein complex AP-1, gamma 2 subunit
Synonyms: gamma 2-adaptin, Adtg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11766
HGNC: HGNC:556
Homologene: 49141
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Oosp1
Name: oocyte secreted protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 170834
Homologene: 87189
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 547253
Homologene: 19697
Steap4
Name: STEAP family member 4
Synonyms: Tiarp, Tnfaip9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 117167
Homologene: 36422
Sun5
Name: Sad1 and UNC84 domain containing 5
Synonyms: 1700021O15Rik, Spag4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76407
Homologene: 12640
Itgb5
Name: integrin beta 5
Synonyms: [b]5B, [b]5A, [b]-5, beta-5, beta5, [b]5, ESTM23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Klhl21
Name: kelch-like 21
Synonyms: 1810045K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242785
Homologene: 8902
9130008F23Rik
Name: RIKEN cDNA 9130008F23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71583
VEGA: 17
Homologene: 51919
Sgcg
Name: sarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonyms: gamma-SG, 5430420E18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 24053
Homologene: 194
4930579C12Rik
Name: RIKEN cDNA 4930579C12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319213
Slc10a5
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 5
Synonyms: LOC241877
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 241877
Homologene: 78106
Tssc4
Name: tumor-suppressing subchromosomal transferable fragment 4
Synonyms: ESTM671070
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56844
Homologene: 4169
Slc6a20b
Name: solute carrier family 6 (neurotransmitter transporter), member 20B
Synonyms: XT3, Xtrp3, Sit1, Slc6a20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22599
Homologene: 130652
Pabpc4l
Name: poly(A) binding protein, cytoplasmic 4-like
Synonyms: C330050A14Rik, EG241989
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 241989
Homologene: 66336
Jpt2
Name: Jupiter microtubule associated homolog 2
Synonyms: 2810430B18Rik, D17Ertd441e, Hn1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52009
VEGA: 17
Homologene: 16934
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108052
Homologene: 9285
Hoxa10
Name: homeobox A10
Synonyms: Hoxa-10, Hox-1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15395
HGNC: HGNC:5100
Homologene: 7365
Cd300lf
Name: CD300 molecule like family member F
Synonyms: Pigr3, CLM-1, IgSF13, IREM1, F730004D16Rik, DIgR2, LMIR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 246746
Homologene: 51396
AU015836
Name: expressed sequence AU015836
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 385493
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 90,803,711 bp
  • T to C, chromosome 1 at 106,318,850 bp
  • T to A, chromosome 1 at 107,524,607 bp
  • T to C, chromosome 1 at 119,549,172 bp
  • A to T, chromosome 1 at 140,584,293 bp
  • A to G, chromosome 1 at 158,505,316 bp
  • A to T, chromosome 2 at 14,308,677 bp
  • G to T, chromosome 2 at 25,353,679 bp
  • A to T, chromosome 2 at 40,919,167 bp
  • A to G, chromosome 2 at 44,591,914 bp
  • A to G, chromosome 2 at 76,758,532 bp
  • T to C, chromosome 2 at 109,341,148 bp
  • C to T, chromosome 2 at 126,777,898 bp
  • T to A, chromosome 2 at 152,318,356 bp
  • C to A, chromosome 2 at 153,676,759 bp
  • T to A, chromosome 2 at 153,865,995 bp
  • C to T, chromosome 2 at 168,217,735 bp
  • T to C, chromosome 3 at 10,335,490 bp
  • A to T, chromosome 3 at 46,446,363 bp
  • C to T, chromosome 3 at 97,165,885 bp
  • A to G, chromosome 4 at 3,614,928 bp
  • A to T, chromosome 4 at 40,164,607 bp
  • T to C, chromosome 4 at 141,249,313 bp
  • C to G, chromosome 4 at 148,156,269 bp
  • T to C, chromosome 4 at 152,015,420 bp
  • G to T, chromosome 5 at 7,975,892 bp
  • A to G, chromosome 5 at 12,485,021 bp
  • A to G, chromosome 5 at 63,807,666 bp
  • T to C, chromosome 5 at 73,012,147 bp
  • T to C, chromosome 5 at 122,433,476 bp
  • C to A, chromosome 5 at 123,653,496 bp
  • A to G, chromosome 5 at 138,192,840 bp
  • GGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTG, chromosome 6 at 52,234,492 bp
  • T to A, chromosome 6 at 57,662,075 bp
  • T to A, chromosome 6 at 87,378,155 bp
  • T to C, chromosome 6 at 115,894,421 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • T to A, chromosome 7 at 24,003,207 bp
  • T to C, chromosome 7 at 49,951,434 bp
  • C to T, chromosome 7 at 56,189,813 bp
  • A to C, chromosome 7 at 76,589,381 bp
  • T to C, chromosome 7 at 79,710,463 bp
  • G to A, chromosome 7 at 89,882,294 bp
  • T to A, chromosome 7 at 102,160,716 bp
  • T to C, chromosome 7 at 126,953,496 bp
  • A to C, chromosome 7 at 143,070,555 bp
  • A to G, chromosome 7 at 143,079,244 bp
  • C to A, chromosome 7 at 144,186,858 bp
  • C to T, chromosome 8 at 25,175,253 bp
  • T to C, chromosome 8 at 70,451,733 bp
  • T to C, chromosome 8 at 122,572,052 bp
  • T to C, chromosome 9 at 15,332,103 bp
  • T to A, chromosome 9 at 21,404,767 bp
  • T to C, chromosome 9 at 48,326,614 bp
  • A to G, chromosome 9 at 89,152,762 bp
  • G to T, chromosome 9 at 123,632,204 bp
  • A to T, chromosome 10 at 77,548,623 bp
  • A to G, chromosome 10 at 93,034,710 bp
  • A to G, chromosome 11 at 34,088,121 bp
  • T to A, chromosome 11 at 46,150,733 bp
  • C to G, chromosome 11 at 77,449,745 bp
  • T to C, chromosome 11 at 109,673,554 bp
  • A to G, chromosome 11 at 115,120,380 bp
  • T to C, chromosome 11 at 118,478,933 bp
  • C to A, chromosome 12 at 72,304,410 bp
  • T to A, chromosome 13 at 24,693,887 bp
  • T to C, chromosome 13 at 112,887,490 bp
  • A to G, chromosome 14 at 26,925,513 bp
  • T to A, chromosome 14 at 55,101,429 bp
  • A to G, chromosome 14 at 56,558,725 bp
  • A to G, chromosome 14 at 61,229,655 bp
  • T to C, chromosome 15 at 31,459,193 bp
  • T to C, chromosome 15 at 58,899,497 bp
  • T to C, chromosome 15 at 68,101,539 bp
  • T to C, chromosome 15 at 76,602,156 bp
  • T to C, chromosome 16 at 29,625,585 bp
  • T to G, chromosome 16 at 33,910,469 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • T to G, chromosome 16 at 59,314,963 bp
  • T to C, chromosome 16 at 66,882,795 bp
  • T to C, chromosome 17 at 24,960,611 bp
  • A to G, chromosome 17 at 34,695,825 bp
  • A to G, chromosome 17 at 35,345,176 bp
  • T to C, chromosome 17 at 40,880,302 bp
  • C to T, chromosome 18 at 37,962,803 bp
  • T to C, chromosome 18 at 78,109,697 bp
  • T to C, chromosome 19 at 5,672,656 bp
  • C to T, chromosome 19 at 11,667,794 bp
  • T to C, chromosome 19 at 34,941,208 bp
  • T to C, chromosome 19 at 41,559,128 bp
  • T to C, chromosome X at 93,969,379 bp
  • A to T, chromosome Y at 1,448,829 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1889 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039910-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.