Strain Name:
C57BL/6J-MtgxR1889Btlr/Mmmh
Stock Number:
039910-MU
Citation ID:
RRID:MMRRC_039910-MU
Other Names:
R1889 (G1), C57BL/6J-MtgxR1889Btlr
Major Collection:

Gene Information

Gene Symbol: Slc6a5 [MGI:105090] (Mus musculus (mouse))
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Chromosome: 7
Alteration at locus: Chemically Induced
Gene Symbol: Lcor [MGI:2443930] (Mus musculus (mouse))
Name: ligand dependent nuclear receptor corepressor
Synonyms: A630025C20Rik, Mlr2, 3110023F06Rik
Chromosome: 19
Alteration at locus: Chemically Induced
Gene Symbol: Epb41l5 [MGI:103006] (Mus musculus (mouse))
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: 1700030C16Rik, E230025E14Rik, Lulu1, NBL5, Epb4.1l5
Chromosome: 1
Alteration at locus: Chemically Induced
Gene Symbol: Zfat [MGI:2681865] (Mus musculus (mouse))
Name: zinc finger and AT hook domain containing
Synonyms: Zfp406, LOC380993, Zfat1
Chromosome: 15
Alteration at locus: Chemically Induced
Gene Symbol: Dnmt3b [MGI:1261819] (Mus musculus (mouse))
Name: DNA methyltransferase 3B
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Kif20b [MGI:2444576] (Mus musculus (mouse))
Name: kinesin family member 20B
Synonyms: Mphosph1, N-6 kinesin, 33cex, magoo, Kif20b, C330014J10Rik
Chromosome: 19
Alteration at locus: Chemically Induced
Gene Symbol: Ilf3 [MGI:1339973] (Mus musculus (mouse))
Name: interleukin enhancer binding factor 3
Synonyms: NF90
Chromosome: 9
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 90,803,711 bp
  • T to C, chromosome 1 at 106,318,850 bp
  • T to A, chromosome 1 at 107,524,607 bp
  • T to C, chromosome 1 at 119,549,172 bp
  • A to T, chromosome 1 at 140,584,293 bp
  • A to G, chromosome 1 at 158,505,316 bp
  • A to T, chromosome 2 at 14,308,677 bp
  • G to T, chromosome 2 at 25,353,679 bp
  • A to T, chromosome 2 at 40,919,167 bp
  • A to G, chromosome 2 at 44,591,914 bp
  • A to G, chromosome 2 at 76,758,532 bp
  • T to C, chromosome 2 at 109,341,148 bp
  • C to T, chromosome 2 at 126,777,898 bp
  • T to A, chromosome 2 at 152,318,356 bp
  • C to A, chromosome 2 at 153,676,759 bp
  • T to A, chromosome 2 at 153,865,995 bp
  • C to T, chromosome 2 at 168,217,735 bp
  • T to C, chromosome 3 at 10,335,490 bp
  • A to T, chromosome 3 at 46,446,363 bp
  • C to T, chromosome 3 at 97,165,885 bp
  • A to G, chromosome 4 at 3,614,928 bp
  • A to T, chromosome 4 at 40,164,607 bp
  • T to C, chromosome 4 at 141,249,313 bp
  • C to G, chromosome 4 at 148,156,269 bp
  • T to C, chromosome 4 at 152,015,420 bp
  • G to T, chromosome 5 at 7,975,892 bp
  • A to G, chromosome 5 at 12,485,021 bp
  • A to G, chromosome 5 at 63,807,666 bp
  • T to C, chromosome 5 at 73,012,147 bp
  • T to C, chromosome 5 at 122,433,476 bp
  • C to A, chromosome 5 at 123,653,496 bp
  • A to G, chromosome 5 at 138,192,840 bp
  • GGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTG, chromosome 6 at 52,234,492 bp
  • T to A, chromosome 6 at 57,662,075 bp
  • T to A, chromosome 6 at 87,378,155 bp
  • T to C, chromosome 6 at 115,894,421 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • T to A, chromosome 7 at 24,003,207 bp
  • T to C, chromosome 7 at 49,951,434 bp
  • C to T, chromosome 7 at 56,189,813 bp
  • A to C, chromosome 7 at 76,589,381 bp
  • T to C, chromosome 7 at 79,710,463 bp
  • G to A, chromosome 7 at 89,882,294 bp
  • T to A, chromosome 7 at 102,160,716 bp
  • T to C, chromosome 7 at 126,953,496 bp
  • A to C, chromosome 7 at 143,070,555 bp
  • A to G, chromosome 7 at 143,079,244 bp
  • C to A, chromosome 7 at 144,186,858 bp
  • C to T, chromosome 8 at 25,175,253 bp
  • T to C, chromosome 8 at 70,451,733 bp
  • T to C, chromosome 8 at 122,572,052 bp
  • T to C, chromosome 9 at 15,332,103 bp
  • T to A, chromosome 9 at 21,404,767 bp
  • T to C, chromosome 9 at 48,326,614 bp
  • A to G, chromosome 9 at 89,152,762 bp
  • G to T, chromosome 9 at 123,632,204 bp
  • A to T, chromosome 10 at 77,548,623 bp
  • A to G, chromosome 10 at 93,034,710 bp
  • A to G, chromosome 11 at 34,088,121 bp
  • T to A, chromosome 11 at 46,150,733 bp
  • C to G, chromosome 11 at 77,449,745 bp
  • T to C, chromosome 11 at 109,673,554 bp
  • A to G, chromosome 11 at 115,120,380 bp
  • T to C, chromosome 11 at 118,478,933 bp
  • C to A, chromosome 12 at 72,304,410 bp
  • T to A, chromosome 13 at 24,693,887 bp
  • T to C, chromosome 13 at 112,887,490 bp
  • A to G, chromosome 14 at 26,925,513 bp
  • T to A, chromosome 14 at 55,101,429 bp
  • A to G, chromosome 14 at 56,558,725 bp
  • A to G, chromosome 14 at 61,229,655 bp
  • T to C, chromosome 15 at 31,459,193 bp
  • T to C, chromosome 15 at 58,899,497 bp
  • T to C, chromosome 15 at 68,101,539 bp
  • T to C, chromosome 15 at 76,602,156 bp
  • T to C, chromosome 16 at 29,625,585 bp
  • T to G, chromosome 16 at 33,910,469 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • T to G, chromosome 16 at 59,314,963 bp
  • T to C, chromosome 16 at 66,882,795 bp
  • T to C, chromosome 17 at 24,960,611 bp
  • A to G, chromosome 17 at 34,695,825 bp
  • A to G, chromosome 17 at 35,345,176 bp
  • T to C, chromosome 17 at 40,880,302 bp
  • C to T, chromosome 18 at 37,962,803 bp
  • T to C, chromosome 18 at 78,109,697 bp
  • T to C, chromosome 19 at 5,672,656 bp
  • C to T, chromosome 19 at 11,667,794 bp
  • T to C, chromosome 19 at 34,941,208 bp
  • T to C, chromosome 19 at 41,559,128 bp
  • T to C, chromosome X at 93,969,379 bp
  • A to T, chromosome Y at 1,448,829 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1889 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039910-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.