Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1901Btlr/Mmmh
Stock Number:
039921-MU
Citation ID:
RRID:MMRRC_039921-MU
Other Names:
R1901 (G1), C57BL/6J-MtgxR1901Btlr
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Nagk
Name: N-acetylglucosamine kinase
Synonyms: GlcNAc kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56174
Homologene: 9720
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Glo1
Name: glyoxalase 1
Synonyms: Glo-1s, Glo-1r, Glo-1, Qglo, Glo1-s, Glo1-r, 0610009E22Rik, 2510049H23Rik, 1110008E19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 109801
VEGA: 17
HGNC: HGNC:4323
Homologene: 4880
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,536,997 bp
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • T to A, chromosome 1 at 97,072,982 bp
  • T to G, chromosome 1 at 135,472,410 bp
  • A to T, chromosome 1 at 160,224,376 bp
  • A to T, chromosome 1 at 174,369,168 bp
  • A to G, chromosome 2 at 26,322,650 bp
  • A to G, chromosome 2 at 27,960,444 bp
  • A to G, chromosome 2 at 38,582,446 bp
  • A to T, chromosome 2 at 39,047,780 bp
  • A to G, chromosome 2 at 172,378,016 bp
  • C to T, chromosome 2 at 180,283,313 bp
  • A to T, chromosome 3 at 93,396,710 bp
  • G to A, chromosome 3 at 138,288,797 bp
  • T to C, chromosome 4 at 21,735,483 bp
  • C to T, chromosome 4 at 62,385,605 bp
  • G to T, chromosome 4 at 128,790,276 bp
  • T to A, chromosome 4 at 130,385,975 bp
  • A to T, chromosome 4 at 135,750,908 bp
  • G to A, chromosome 5 at 30,385,865 bp
  • T to A, chromosome 5 at 73,671,139 bp
  • A to C, chromosome 5 at 107,369,295 bp
  • A to T, chromosome 5 at 114,165,734 bp
  • T to A, chromosome 5 at 125,025,425 bp
  • A to C, chromosome 6 at 67,423,734 bp
  • G to T, chromosome 6 at 83,799,354 bp
  • A to G, chromosome 6 at 90,224,286 bp
  • T to C, chromosome 6 at 113,469,704 bp
  • A to G, chromosome 6 at 121,881,821 bp
  • C to A, chromosome 6 at 122,071,842 bp
  • A to T, chromosome 6 at 125,872,684 bp
  • T to C, chromosome 6 at 132,910,176 bp
  • C to T, chromosome 7 at 20,844,273 bp
  • A to C, chromosome 7 at 23,423,910 bp
  • C to A, chromosome 7 at 23,808,793 bp
  • A to G, chromosome 7 at 30,657,245 bp
  • C to T, chromosome 7 at 79,838,256 bp
  • T to C, chromosome 7 at 99,470,220 bp
  • T to C, chromosome 7 at 101,823,377 bp
  • T to C, chromosome 7 at 103,683,543 bp
  • A to G, chromosome 7 at 105,180,872 bp
  • A to G, chromosome 7 at 120,346,099 bp
  • T to C, chromosome 7 at 143,703,181 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • T to C, chromosome 8 at 95,743,121 bp
  • T to C, chromosome 8 at 105,313,075 bp
  • A to T, chromosome 8 at 123,893,161 bp
  • A to G, chromosome 9 at 22,351,043 bp
  • A to T, chromosome 9 at 45,256,356 bp
  • G to A, chromosome 9 at 108,040,996 bp
  • T to C, chromosome 9 at 109,113,635 bp
  • T to C, chromosome 9 at 119,102,644 bp
  • T to A, chromosome 9 at 119,779,036 bp
  • A to G, chromosome 10 at 7,775,216 bp
  • A to G, chromosome 10 at 22,371,451 bp
  • A to T, chromosome 10 at 34,313,671 bp
  • G to A, chromosome 10 at 40,056,606 bp
  • A to T, chromosome 10 at 69,822,337 bp
  • G to T, chromosome 10 at 88,753,026 bp
  • A to G, chromosome 10 at 89,429,024 bp
  • A to G, chromosome 10 at 93,707,372 bp
  • A to G, chromosome 10 at 105,826,087 bp
  • T to A, chromosome 10 at 108,198,891 bp
  • T to C, chromosome 10 at 127,498,468 bp
  • T to A, chromosome 10 at 128,043,721 bp
  • A to G, chromosome 11 at 69,825,900 bp
  • T to G, chromosome 11 at 75,504,744 bp
  • G to A, chromosome 11 at 94,946,632 bp
  • G to A, chromosome 11 at 98,327,732 bp
  • T to A, chromosome 11 at 116,107,779 bp
  • A to G, chromosome 11 at 117,723,005 bp
  • C to A, chromosome 12 at 95,779,130 bp
  • C to T, chromosome 12 at 95,779,131 bp
  • A to T, chromosome 13 at 55,401,150 bp
  • T to A, chromosome 13 at 73,670,043 bp
  • A to G, chromosome 13 at 74,480,945 bp
  • A to G, chromosome 13 at 120,317,724 bp
  • T to C, chromosome 14 at 32,566,464 bp
  • T to C, chromosome 14 at 121,625,153 bp
  • G to T, chromosome 15 at 9,607,377 bp
  • T to A, chromosome 15 at 76,175,551 bp
  • A to G, chromosome 15 at 76,436,049 bp
  • C to A, chromosome 15 at 89,116,241 bp
  • A to T, chromosome 15 at 101,946,963 bp
  • C to A, chromosome 15 at 102,460,698 bp
  • G to T, chromosome 16 at 17,673,154 bp
  • G to T, chromosome 16 at 20,604,832 bp
  • A to T, chromosome 16 at 33,284,438 bp
  • A to G, chromosome 16 at 44,287,351 bp
  • A to C, chromosome 16 at 44,422,374 bp
  • A to T, chromosome 16 at 59,362,163 bp
  • A to G, chromosome 16 at 72,960,204 bp
  • A to G, chromosome 17 at 13,081,626 bp
  • T to G, chromosome 17 at 30,596,408 bp
  • A to G, chromosome 17 at 34,283,233 bp
  • A to G, chromosome 17 at 36,901,800 bp
  • T to A, chromosome 17 at 37,701,421 bp
  • A to T, chromosome 17 at 42,503,616 bp
  • T to C, chromosome 17 at 46,655,740 bp
  • A to G, chromosome 17 at 56,129,400 bp
  • A to T, chromosome 17 at 65,986,703 bp
  • T to A, chromosome 18 at 37,437,630 bp
  • T to A, chromosome 18 at 77,097,443 bp
  • T to C, chromosome 19 at 3,965,130 bp
  • T to C, chromosome 19 at 27,241,309 bp
  • T to C, chromosome 19 at 28,531,585 bp
  • A to G, chromosome Y at 1,303,371 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1901 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039921-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.