Strain Name:
C57BL/6J-MtgxR1901Btlr/Mmmh
Stock Number:
039921-MU
Citation ID:
RRID:MMRRC_039921-MU
Other Names:
R1901 (G1), C57BL/6J-MtgxR1901Btlr
Major Collection:

Gene Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arhgef7
Name: Rho guanine nucleotide exchange factor (GEF7)
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54126
Homologene: 2895
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22359
Homologene: 443
Nagk
Name: N-acetylglucosamine kinase
Synonyms: GlcNAc kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56174
Homologene: 9720
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 27399
Homologene: 56602
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Glo1
Name: glyoxalase 1
Synonyms: Glo-1s, Glo-1r, Glo-1, Qglo, Glo1-s, Glo1-r, 0610009E22Rik, 2510049H23Rik, 1110008E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 109801
VEGA: 17
HGNC: HGNC:4323
Homologene: 4880
Pias2
Name: protein inhibitor of activated STAT 2
Synonyms: Dib, 6330408K17Rik, ARIP3, PIASxbeta, PIASxalpha, PIASxb, Miz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17344
VEGA: 18
Homologene: 20979
Snx4
Name: sorting nexin 4
Synonyms: 1810036H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 69150
VEGA: 16
Homologene: 36143
Nek6
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59126
HGNC: HGNC:7749
Homologene: 49379
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105445
Homologene: 41026
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106585
Homologene: 9059
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94112
VEGA: 16
Prr13
Name: proline rich 13
Synonyms: 2010324E22Rik, 1110020C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66151
Homologene: 134002
Cstf1
Name: cleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms: 1700057K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67337
HGNC: HGNC:2483
Homologene: 1012
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71750
Homologene: 8954
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Mettl25
Name: methyltransferase like 25
Synonyms: BC067068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216292
Homologene: 32774
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192159
Homologene: 4706
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Golga1
Name: golgi autoantigen, golgin subfamily a, 1
Synonyms: golgin-97, 0710001G09Rik, 2210418B03Rik, Golgi97, awag
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76899
HGNC: HGNC:4424
Homologene: 68223
Gpsm1
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: 1810037C22Rik, Ags3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67839
Homologene: 16987
Otof
Name: otoferlin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 83762
HGNC: HGNC:8515
Homologene: 12892
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19876
Homologene: 2206
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Snrnp40
Name: small nuclear ribonucleoprotein 40 (U5)
Synonyms: 0610009C03Rik, Wdr57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66585
Homologene: 3538
Cul7
Name: cullin 7
Synonyms: p193, 2510004L20Rik, p185, C230011P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66515
Homologene: 56683
Flrt2
Name: fibronectin leucine rich transmembrane protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 399558
HGNC: HGNC:3761
Homologene: 8291
Il17re
Name: interleukin 17 receptor E
Synonyms: Il25r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 57890
Homologene: 17109
Il22ra1
Name: interleukin 22 receptor, alpha 1
Synonyms: Il22r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230828
Homologene: 10943
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Tnrc6c
Name: trinucleotide repeat containing 6C
Synonyms: 9930033H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217351
Homologene: 23137
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, Plekhm1l, 9430067K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241075
Homologene: 18459
Anpep
Name: alanyl (membrane) aminopeptidase
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Acta1
Name: actin, alpha 1, skeletal muscle
Synonyms: Actsk-1, Acts
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11459
HGNC: HGNC:129
Homologene: 121702
Ginm1
Name: glycoprotein integral membrane 1
Synonyms: BC013529
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215751
Homologene: 16347
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216856
Homologene: 69317
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Tubgcp6
Name: tubulin, gamma complex associated protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 328580
Homologene: 32477
Sema6b
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms: VIb, semaZ, Sema, Seman
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20359
VEGA: 17
Homologene: 8428
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, D630001K16Rik, Xtrp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 22598
VEGA: 13
Homologene: 40785
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212517
Homologene: 75085
Il23r
Name: interleukin 23 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 209590
Homologene: 16930
Abca15
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320631
Homologene: 87255
Olfr209
Name: olfactory receptor 209
Synonyms: GA_x54KRFPKG5P-55590495-55589578, MOR182-6, MOR182-6, GA_x54KRFPKG5P-55580232-55579315, Olfr208
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 404311
Homologene: 133040
Slc16a10
Name: solute carrier family 16 (monocarboxylic acid transporters), member 10
Synonyms: PRO0813, TAT1, 2610103N14Rik, Mct10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72472
VEGA: 10
Homologene: 75089
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Haus5
Name: HAUS augmin-like complex, subunit 5
Synonyms: 2310022K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71909
Homologene: 18969
Rabgap1l
Name: RAB GTPase activating protein 1-like
Synonyms: Hh1, 9630005B12Rik, 5830411O09Rik, 8430421H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 29809
Homologene: 8143
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223658
Homologene: 44882
Glis3
Name: GLIS family zinc finger 3
Synonyms: E330013K21Rik, 4833409N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226075
Homologene: 34989
Il10ra
Name: interleukin 10 receptor, alpha
Synonyms: mIL-10R, Il10r, CDw210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16154
HGNC: HGNC:5964
Homologene: 1196
Nt5dc1
Name: 5'-nucleotidase domain containing 1
Synonyms: 6030401B09Rik, Nt5c2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319638
Homologene: 16281
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74441
Homologene: 65259
Vmn1r53
Name: vomeronasal 1 receptor 53
Synonyms: VN5, V1rb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113853
Homologene: 113975
Tas2r125
Name: taste receptor, type 2, member 125
Synonyms: Tas2r25, T2R26, mGR25, mt2r59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387352
Homologene: 87294
Krt78
Name: keratin 78
Synonyms: 2310030B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 332131
VEGA: 15
Homologene: 65261
Olfr119
Name: olfactory receptor 119
Synonyms: MOR263-7, GA_x6K02T2PSCP-2159633-2160598
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258095
Homologene: 17195
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17836
Homologene: 136663
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320277
Homologene: 23371
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17837
Homologene: 136663
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Olfr417
Name: olfactory receptor 417
Synonyms: GA_x6K02T2P20D-20787051-20786119, MOR267-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258238
Homologene: 17358
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 57764
Homologene: 10934
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Trim47
Name: tripartite motif-containing 47
Synonyms: 2210023F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217333
Homologene: 14128
Slc34a1
Name: solute carrier family 34 (sodium phosphate), member 1
Synonyms: renal Na+/Pi transporter, Na/Pi cotransporter, Slc17a2, Npt2, NaPi-IIa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20505
VEGA: 13
Homologene: 20663
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 328643
Homologene: 28056
Pcdhb12
Name: protocadherin beta 12
Synonyms: Pcdhb5F, PcdhbL, Pcdh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
Homologene: 87126
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 79196
Homologene: 98024
Raet1d
Name: retinoic acid early transcript delta
Synonyms: RAE-1delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56554
Homologene: 134115
Vmn1r115
Name: vomeronasal 1 receptor 115
Synonyms: Gm8549
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 667273
Homologene: 104166
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72184
Homologene: 27849
Sidt1
Name: SID1 transmembrane family, member 1
Synonyms: B830021E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320007
Homologene: 41189
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23968
Homologene: 65105
Spata18
Name: spermatogenesis associated 18
Synonyms: 1700067I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 73472
Homologene: 17057
Rbbp8nl
Name: RBBP8 N-terminal like
Synonyms: BC066135
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271887
Homologene: 76811
Aldh3b3
Name: aldehyde dehydrogenase 3 family, member B3
Synonyms: 1700055N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 73458
HGNC: HGNC:411
Homologene: 133295
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11522
Homologene: 73888
Slc31a1
Name: solute carrier family 31, member 1
Synonyms: Ctr1, 4930445G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20529
Homologene: 1399
Lrrc29
Name: leucine rich repeat containing 29
Synonyms: FBXL9, FBL9, A630024J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234684
Homologene: 133339
Brdt
Name: bromodomain, testis-specific
Synonyms: 7420412D09Rik, Brd6, Fsrg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 114642
HGNC: HGNC:1105
Homologene: 21064
Olfr685
Name: olfactory receptor 685
Synonyms: GA_x6K02T2PBJ9-7810071-7809121, MOR37-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258160
Homologene: 66455
Neurod2
Name: neurogenic differentiation 2
Synonyms: Ndrf, bHLHa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18013
HGNC: HGNC:7763
Homologene: 4489
Rptn
Name: repetin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20129
Homologene: 84780
Olfr625-ps1
Name: olfactory receptor 625, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-6416276-6417237, MOR31-15P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258169
Vmn1r175
Name: vomeronasal 1 receptor 175
Synonyms: Gm6299
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 622222
Homologene: 128341
Ccnc
Name: cyclin C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 51813
HGNC: HGNC:1581
Homologene: 3803
Zfp362
Name: zinc finger protein 362
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230761
Homologene: 77409
Trim31
Name: tripartite motif-containing 31
Synonyms: HCG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224762
Homologene: 17137
H2-Aa
Name: histocompatibility 2, class II antigen A, alpha
Synonyms: Aalpha, A alpha, Ia-1, Ia1, H-2Aa, I-Aalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14960
HGNC: HGNC:4942
Homologene: 123820
Zfp825
Name: zinc finger protein 825
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 235956
Tcp10b
Name: t-complex protein 10b
Synonyms: T66B-a, D17Leh66ba, D17Leh66B, Tcp-10b, Tcp-10bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21462
Homologene: 83254
Tcstv3
Name: 2-cell-stage, variable group, member 3
Synonyms: clone L3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 236219
VEGA: 13
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,536,997 bp
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • T to A, chromosome 1 at 97,072,982 bp
  • T to G, chromosome 1 at 135,472,410 bp
  • A to T, chromosome 1 at 160,224,376 bp
  • A to T, chromosome 1 at 174,369,168 bp
  • A to G, chromosome 2 at 26,322,650 bp
  • A to G, chromosome 2 at 27,960,444 bp
  • A to G, chromosome 2 at 38,582,446 bp
  • A to T, chromosome 2 at 39,047,780 bp
  • A to G, chromosome 2 at 172,378,016 bp
  • C to T, chromosome 2 at 180,283,313 bp
  • A to T, chromosome 3 at 93,396,710 bp
  • G to A, chromosome 3 at 138,288,797 bp
  • T to C, chromosome 4 at 21,735,483 bp
  • C to T, chromosome 4 at 62,385,605 bp
  • G to T, chromosome 4 at 128,790,276 bp
  • T to A, chromosome 4 at 130,385,975 bp
  • A to T, chromosome 4 at 135,750,908 bp
  • G to A, chromosome 5 at 30,385,865 bp
  • T to A, chromosome 5 at 73,671,139 bp
  • A to C, chromosome 5 at 107,369,295 bp
  • A to T, chromosome 5 at 114,165,734 bp
  • T to A, chromosome 5 at 125,025,425 bp
  • A to C, chromosome 6 at 67,423,734 bp
  • G to T, chromosome 6 at 83,799,354 bp
  • A to G, chromosome 6 at 90,224,286 bp
  • T to C, chromosome 6 at 113,469,704 bp
  • A to G, chromosome 6 at 121,881,821 bp
  • C to A, chromosome 6 at 122,071,842 bp
  • A to T, chromosome 6 at 125,872,684 bp
  • T to C, chromosome 6 at 132,910,176 bp
  • C to T, chromosome 7 at 20,844,273 bp
  • A to C, chromosome 7 at 23,423,910 bp
  • C to A, chromosome 7 at 23,808,793 bp
  • A to G, chromosome 7 at 30,657,245 bp
  • C to T, chromosome 7 at 79,838,256 bp
  • T to C, chromosome 7 at 99,470,220 bp
  • T to C, chromosome 7 at 101,823,377 bp
  • T to C, chromosome 7 at 103,683,543 bp
  • A to G, chromosome 7 at 105,180,872 bp
  • A to G, chromosome 7 at 120,346,099 bp
  • T to C, chromosome 7 at 143,703,181 bp
  • C to A, chromosome 8 at 11,808,712 bp
  • C to A, chromosome 8 at 11,808,713 bp
  • T to C, chromosome 8 at 95,743,121 bp
  • T to C, chromosome 8 at 105,313,075 bp
  • A to T, chromosome 8 at 123,893,161 bp
  • A to G, chromosome 9 at 22,351,043 bp
  • A to T, chromosome 9 at 45,256,356 bp
  • G to A, chromosome 9 at 108,040,996 bp
  • T to C, chromosome 9 at 109,113,635 bp
  • T to C, chromosome 9 at 119,102,644 bp
  • T to A, chromosome 9 at 119,779,036 bp
  • A to G, chromosome 10 at 7,775,216 bp
  • A to G, chromosome 10 at 22,371,451 bp
  • A to T, chromosome 10 at 34,313,671 bp
  • G to A, chromosome 10 at 40,056,606 bp
  • A to T, chromosome 10 at 69,822,337 bp
  • G to T, chromosome 10 at 88,753,026 bp
  • A to G, chromosome 10 at 89,429,024 bp
  • A to G, chromosome 10 at 93,707,372 bp
  • A to G, chromosome 10 at 105,826,087 bp
  • T to A, chromosome 10 at 108,198,891 bp
  • T to C, chromosome 10 at 127,498,468 bp
  • T to A, chromosome 10 at 128,043,721 bp
  • A to G, chromosome 11 at 69,825,900 bp
  • T to G, chromosome 11 at 75,504,744 bp
  • G to A, chromosome 11 at 94,946,632 bp
  • G to A, chromosome 11 at 98,327,732 bp
  • T to A, chromosome 11 at 116,107,779 bp
  • A to G, chromosome 11 at 117,723,005 bp
  • C to A, chromosome 12 at 95,779,130 bp
  • C to T, chromosome 12 at 95,779,131 bp
  • A to T, chromosome 13 at 55,401,150 bp
  • T to A, chromosome 13 at 73,670,043 bp
  • A to G, chromosome 13 at 74,480,945 bp
  • A to G, chromosome 13 at 120,317,724 bp
  • T to C, chromosome 14 at 32,566,464 bp
  • T to C, chromosome 14 at 121,625,153 bp
  • G to T, chromosome 15 at 9,607,377 bp
  • T to A, chromosome 15 at 76,175,551 bp
  • A to G, chromosome 15 at 76,436,049 bp
  • C to A, chromosome 15 at 89,116,241 bp
  • A to T, chromosome 15 at 101,946,963 bp
  • C to A, chromosome 15 at 102,460,698 bp
  • G to T, chromosome 16 at 17,673,154 bp
  • G to T, chromosome 16 at 20,604,832 bp
  • A to T, chromosome 16 at 33,284,438 bp
  • A to G, chromosome 16 at 44,287,351 bp
  • A to C, chromosome 16 at 44,422,374 bp
  • A to T, chromosome 16 at 59,362,163 bp
  • A to G, chromosome 16 at 72,960,204 bp
  • A to G, chromosome 17 at 13,081,626 bp
  • T to G, chromosome 17 at 30,596,408 bp
  • A to G, chromosome 17 at 34,283,233 bp
  • A to G, chromosome 17 at 36,901,800 bp
  • T to A, chromosome 17 at 37,701,421 bp
  • A to T, chromosome 17 at 42,503,616 bp
  • T to C, chromosome 17 at 46,655,740 bp
  • A to G, chromosome 17 at 56,129,400 bp
  • A to T, chromosome 17 at 65,986,703 bp
  • T to A, chromosome 18 at 37,437,630 bp
  • T to A, chromosome 18 at 77,097,443 bp
  • T to C, chromosome 19 at 3,965,130 bp
  • T to C, chromosome 19 at 27,241,309 bp
  • T to C, chromosome 19 at 28,531,585 bp
  • A to G, chromosome Y at 1,303,371 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1901 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039921-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.