Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1980Btlr/Mmmh
Stock Number:
039992-MU
Citation ID:
RRID:MMRRC_039992-MU
Other Names:
R1980 (G1), C57BL/6J-MtgxR1980Btlr
Major Collection:

Strain Information

Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Upp1
Name: uridine phosphorylase 1
Synonyms: UdRPase, UPase, Up
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22271
Homologene: 2524
Ciapin1
Name: cytokine induced apoptosis inhibitor 1
Synonyms: anamorsin, 2810413N20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109006
Homologene: 10658
Lpp
Name: LIM domain containing preferred translocation partner in lipoma
Synonyms: B130055L10Rik, 9430020K16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210126
VEGA: 16
HGNC: HGNC:6679
Homologene: 4075
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320713
Homologene: 66204
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,505,836 bp
  • A to T, chromosome 1 at 189,653,915 bp
  • C to T, chromosome 2 at 29,722,227 bp
  • T to C, chromosome 2 at 58,024,723 bp
  • T to C, chromosome 2 at 94,326,704 bp
  • T to A, chromosome 2 at 111,621,241 bp
  • A to G, chromosome 2 at 119,808,817 bp
  • A to G, chromosome 2 at 164,795,044 bp
  • G to A, chromosome 3 at 30,642,741 bp
  • A to G, chromosome 3 at 52,104,052 bp
  • A to T, chromosome 3 at 79,593,618 bp
  • T to C, chromosome 3 at 88,543,458 bp
  • A to C, chromosome 3 at 97,756,996 bp
  • T to C, chromosome 3 at 132,948,132 bp
  • A to C, chromosome 4 at 46,061,043 bp
  • G to A, chromosome 4 at 49,337,655 bp
  • A to T, chromosome 4 at 94,952,213 bp
  • G to A, chromosome 4 at 108,265,930 bp
  • T to A, chromosome 5 at 3,972,771 bp
  • T to C, chromosome 5 at 38,224,709 bp
  • A to G, chromosome 5 at 87,843,402 bp
  • A to T, chromosome 6 at 129,615,471 bp
  • T to A, chromosome 7 at 12,811,468 bp
  • A to T, chromosome 7 at 30,873,233 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • A to G, chromosome 7 at 43,616,461 bp
  • A to T, chromosome 7 at 44,585,827 bp
  • T to C, chromosome 7 at 64,208,434 bp
  • T to A, chromosome 8 at 22,061,887 bp
  • T to C, chromosome 8 at 69,870,126 bp
  • C to T, chromosome 8 at 94,832,533 bp
  • A to G, chromosome 9 at 22,012,868 bp
  • T to C, chromosome 9 at 96,570,768 bp
  • C to T, chromosome 10 at 10,433,498 bp
  • A to T, chromosome 10 at 77,811,685 bp
  • C to T, chromosome 10 at 77,893,740 bp
  • A to T, chromosome 11 at 9,134,872 bp
  • C to T, chromosome 11 at 23,742,761 bp
  • A to T, chromosome 11 at 29,708,634 bp
  • A to T, chromosome 11 at 30,832,615 bp
  • A to G, chromosome 11 at 58,136,917 bp
  • A to G, chromosome 11 at 58,220,076 bp
  • A to T, chromosome 11 at 70,054,946 bp
  • A to T, chromosome 11 at 70,682,482 bp
  • T to A, chromosome 11 at 78,501,898 bp
  • A to C, chromosome 11 at 100,495,876 bp
  • C to T, chromosome 12 at 83,797,344 bp
  • C to A, chromosome 12 at 103,011,279 bp
  • T to G, chromosome 13 at 21,501,124 bp
  • T to A, chromosome 13 at 51,144,470 bp
  • A to G, chromosome 14 at 8,253,572 bp
  • G to T, chromosome 14 at 12,344,405 bp
  • A to G, chromosome 14 at 97,831,341 bp
  • A to C, chromosome 14 at 100,149,726 bp
  • A to G, chromosome 15 at 77,526,044 bp
  • A to G, chromosome 15 at 82,103,312 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • C to T, chromosome 16 at 24,661,701 bp
  • A to G, chromosome 16 at 79,078,935 bp
  • T to A, chromosome 17 at 20,688,046 bp
  • T to G, chromosome 17 at 37,093,403 bp
  • G to C, chromosome 17 at 45,545,461 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • C to T, chromosome 17 at 56,271,555 bp
  • T to A, chromosome 17 at 66,148,739 bp
  • A to G, chromosome 17 at 70,809,286 bp
  • A to G, chromosome 17 at 91,088,318 bp
  • A to T, chromosome 18 at 20,338,650 bp
  • T to A, chromosome 18 at 59,075,667 bp
  • A to G, chromosome 18 at 61,508,696 bp
  • T to G, chromosome 19 at 41,788,345 bp
  • T to G, chromosome 19 at 47,611,989 bp
  • A to G, chromosome X at 8,331,019 bp
  • A to C, chromosome X at 86,047,134 bp
  • A to T, chromosome X at 89,931,445 bp
  • T to A, chromosome X at 134,318,033 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1980 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039992-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.