Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2010Btlr/Mmmh
Stock Number:
040019-MU
Citation ID:
RRID:MMRRC_040019-MU
Other Names:
R2010 (G1), C57BL/6J-MtgxR2010Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Dhrs3
Name: dehydrogenase/reductase 3
Synonyms: retSDR1, Rsdr1, dehydrogenase/reductase (SDR family) member 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20148
Homologene: 20994
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,296,996 bp
  • C to T, chromosome 1 at 36,445,181 bp
  • T to A, chromosome 1 at 86,075,997 bp
  • T to A, chromosome 1 at 131,812,114 bp
  • T to A, chromosome 1 at 134,969,298 bp
  • T to C, chromosome 1 at 136,274,868 bp
  • A to T, chromosome 1 at 185,278,281 bp
  • G to A, chromosome 3 at 36,481,806 bp
  • T to G, chromosome 3 at 36,928,551 bp
  • T to A, chromosome 3 at 107,879,372 bp
  • A to T, chromosome 3 at 132,667,492 bp
  • C to T, chromosome 3 at 138,555,458 bp
  • T to C, chromosome 3 at 148,839,636 bp
  • A to G, chromosome 3 at 152,766,514 bp
  • T to C, chromosome 4 at 15,969,393 bp
  • C to T, chromosome 4 at 43,415,212 bp
  • T to A, chromosome 4 at 98,970,904 bp
  • T to C, chromosome 4 at 139,480,652 bp
  • C to T, chromosome 4 at 144,927,188 bp
  • A to G, chromosome 5 at 86,046,586 bp
  • T to A, chromosome 5 at 99,024,805 bp
  • C to A, chromosome 5 at 107,813,545 bp
  • T to A, chromosome 5 at 112,369,476 bp
  • C to T, chromosome 5 at 115,341,430 bp
  • C to T, chromosome 5 at 139,973,316 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 5 at 150,775,354 bp
  • A to G, chromosome 6 at 57,258,284 bp
  • A to T, chromosome 6 at 113,593,291 bp
  • A to T, chromosome 6 at 124,537,394 bp
  • A to G, chromosome 6 at 124,810,376 bp
  • A to T, chromosome 6 at 128,435,802 bp
  • A to C, chromosome 6 at 131,687,402 bp
  • G to A, chromosome 6 at 146,227,524 bp
  • A to T, chromosome 7 at 28,288,022 bp
  • A to G, chromosome 7 at 86,664,603 bp
  • T to A, chromosome 7 at 102,094,573 bp
  • T to A, chromosome 7 at 102,877,685 bp
  • T to G, chromosome 7 at 120,095,177 bp
  • C to G, chromosome 7 at 123,171,046 bp
  • A to G, chromosome 7 at 125,872,956 bp
  • T to C, chromosome 7 at 132,966,696 bp
  • A to T, chromosome 7 at 141,700,875 bp
  • G to A, chromosome 8 at 40,587,037 bp
  • G to A, chromosome 8 at 69,791,360 bp
  • A to G, chromosome 8 at 69,881,694 bp
  • C to A, chromosome 9 at 7,567,534 bp
  • T to C, chromosome 9 at 34,939,198 bp
  • T to C, chromosome 9 at 39,060,099 bp
  • T to C, chromosome 9 at 70,320,066 bp
  • C to A, chromosome 9 at 105,403,502 bp
  • T to A, chromosome 9 at 123,702,186 bp
  • T to A, chromosome 10 at 53,475,199 bp
  • C to A, chromosome 10 at 60,314,227 bp
  • A to G, chromosome 10 at 111,975,569 bp
  • A to G, chromosome 11 at 54,482,503 bp
  • G to A, chromosome 11 at 55,253,827 bp
  • T to A, chromosome 11 at 62,458,682 bp
  • A to T, chromosome 11 at 67,297,164 bp
  • A to T, chromosome 11 at 69,458,358 bp
  • T to C, chromosome 11 at 71,281,225 bp
  • T to C, chromosome 11 at 76,398,801 bp
  • T to A, chromosome 11 at 85,040,004 bp
  • T to C, chromosome 11 at 120,272,778 bp
  • C to T, chromosome 12 at 8,301,729 bp
  • A to G, chromosome 12 at 17,416,101 bp
  • C to A, chromosome 12 at 65,227,214 bp
  • C to T, chromosome 12 at 80,960,447 bp
  • A to G, chromosome 12 at 98,254,230 bp
  • T to A, chromosome 12 at 104,217,323 bp
  • C to A, chromosome 12 at 105,623,992 bp
  • T to A, chromosome 12 at 113,271,488 bp
  • T to G, chromosome 12 at 116,122,810 bp
  • T to G, chromosome 13 at 22,524,447 bp
  • T to G, chromosome 13 at 23,076,208 bp
  • G to A, chromosome 13 at 23,747,128 bp
  • A to T, chromosome 14 at 8,511,021 bp
  • A to G, chromosome 14 at 55,497,123 bp
  • T to C, chromosome 14 at 73,294,993 bp
  • T to C, chromosome 15 at 77,771,947 bp
  • T to C, chromosome 15 at 80,247,925 bp
  • A to T, chromosome 15 at 94,551,806 bp
  • A to T, chromosome 15 at 103,315,810 bp
  • A to G, chromosome 16 at 4,608,711 bp
  • C to T, chromosome 17 at 20,913,339 bp
  • T to A, chromosome 18 at 5,082,773 bp
  • A to G, chromosome 19 at 5,719,283 bp
  • A to G, chromosome 19 at 33,973,546 bp
  • G to A, chromosome 19 at 38,301,235 bp
  • A to G, chromosome 19 at 41,872,937 bp
  • T to C, chromosome X at 57,299,505 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2010 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040019-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.