Strain Name:
C57BL/6J-MtgxR2010Btlr/Mmmh
Stock Number:
040019-MU
Citation ID:
RRID:MMRRC_040019-MU
Other Names:
R2010 (G1), C57BL/6J-MtgxR2010Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Dhrs3
Name: dehydrogenase/reductase (SDR family) member 3
Synonyms: retSDR1, Rsdr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20148
Homologene: 20994
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22064
Homologene: 135989
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268515
Homologene: 129585
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: AS3, Aprin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100710
Homologene: 41001
Pigl
Name: phosphatidylinositol glycan anchor biosynthesis, class L
Synonyms: LOC327942
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327942
HGNC: HGNC:8966
Homologene: 3159
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
H2bc3
Name: H2B clustered histone 3
Synonyms: H2b-143, Hist1h2bb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319178
Homologene: 137348
Arhgef6
Name: Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6
Synonyms: 1700038J06Rik, 1600028C08Rik, 4930592P22Rik, alpha-PIX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73341
HGNC: HGNC:685
Homologene: 3561
Vipr2
Name: vasoactive intestinal peptide receptor 2
Synonyms: VIP receptor subtype 2, VPAC2, Vip2, VPAC2R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22355
Homologene: 2540
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233833
Homologene: 41399
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237898
Homologene: 13066
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Psmd1
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms: P112, S1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70247
HGNC: HGNC:9554
Homologene: 2100
Cenpc1
Name: centromere protein C1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12617
HGNC: HGNC:1854
Homologene: 1371
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98732
Homologene: 40842
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99633
Homologene: 22712
Fkbp4
Name: FK506 binding protein 4
Synonyms: FKBP-52, FKBP52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14228
HGNC: HGNC:3720
Homologene: 36085
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229227
Homologene: 52105
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67886
Homologene: 18927
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Aimp1
Name: aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms: Emap2, AIMP1/p43, 9830137A06Rik, Scye1, EMAPII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13722
Homologene: 31260
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: NY-REN-64, IRAK-4, 9330209D03Rik, 8430405M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 266632
Homologene: 41109
Triap1
Name: TP53 regulated inhibitor of apoptosis 1
Synonyms: 1810015M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69076
Homologene: 41131
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67299
Homologene: 23566
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Zranb1
Name: zinc finger, RAN-binding domain containing 1
Synonyms: 9330160G10Rik, D7Wsu87e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 360216
Homologene: 9728
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67703
Homologene: 57050
Rb1
Name: RB transcriptional corepressor 1
Synonyms: pRb, Rb, Rb-1, retinoblastoma 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18230
Homologene: 69028
Krr1
Name: KRR1, small subunit (SSU) processome component, homolog (yeast)
Synonyms: 2610511F02Rik, D10Ertd773e, Hrb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 52705
HGNC: HGNC:5176
Homologene: 5114
Pigk
Name: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: 3000001O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329777
HGNC: HGNC:8965
Homologene: 4002
Glis2
Name: GLIS family zinc finger 2
Synonyms: Nkl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 83396
Homologene: 12821
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225115
Homologene: 25090
Katnip
Name: katanin interacting protein
Synonyms: D430042O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233865
Homologene: 45841
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216742
Homologene: 28173
Eif4e
Name: eukaryotic translation initiation factor 4E
Synonyms: eIF-4E, If4e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13684
HGNC: HGNC:3287
Homologene: 123817
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Elfn1
Name: leucine rich repeat and fibronectin type III, extracellular 1
Synonyms: A930017N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243312
Homologene: 18465
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Prkg2
Name: protein kinase, cGMP-dependent, type II
Synonyms: cGK-II, Prkgr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19092
HGNC: HGNC:9416
Homologene: 4556
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100213
Homologene: 18967
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Or51f2
Name: olfactory receptor family 51 subfamily F member 2
Synonyms: GA_x6K02T2PBJ9-5588278-5589228, MOR14-3, MOR14-11, Olfr568
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259095
Homologene: 81595
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Aste1
Name: asteroid homolog 1
Synonyms: 1100001A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66595
Homologene: 130666
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116837
Homologene: 128399
Or14c40
Name: olfactory receptor family 14 subfamily C member 40
Synonyms: GA_x6K02T2NHDJ-9457744-9456734, MOR221-3, Olfr293
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257906
Homologene: 79385
Eps8l3
Name: EPS8-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99662
Homologene: 15878
C1s1
Name: complement component 1, s subcomponent 1
Synonyms: C1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 50908
HGNC: HGNC:1247
Homologene: 1314
Or8g23
Name: olfactory receptor family 8 subfamily G member 23
Synonyms: GA_x6K02T2PVTD-32756567-32755632, MOR171-24, Olfr937
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258431
VEGA: 9
HGNC: HGNC:8484
Homologene: 27167
Lman2l
Name: lectin, mannose-binding 2-like
Synonyms: VIP36-like, A630028F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214895
Homologene: 57125
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: 2A1, antitrypsin, alpha-1 antiproteinasin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Vmn1r215
Name: vomeronasal 1 receptor 215
Synonyms: V1ri2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171253
Homologene: 110880
Cfap20dc
Name: CFAP20 domain containing
Synonyms: 4930452B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74430
Homologene: 18873
CAAA01221083.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Slc10a1
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 1
Synonyms: sodium bile acid cotransporting polypeptide, Ntcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20493
VEGA: 12
Homologene: 31126
Galc
Name: galactosylceramidase
Synonyms: Gacy, 2310068B06Rik, galactocerebrosidase, A930008M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: CLIP-2, 1110031K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 68709
Homologene: 17713
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Lztfl1
Name: leucine zipper transcription factor-like 1
Synonyms: 5530402H04Rik, 6130400H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 93730
HGNC: HGNC:6741
Homologene: 41368
Selenov
Name: selenoprotein V
Synonyms: BC089491
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 280621
Homologene: 35357
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: 4921538B03Rik, 4930427E19Rik, Wdr20b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 70948
VEGA: 12
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113863
Homologene: 123826
Vmn1r203
Name: vomeronasal 1 receptor 203
Synonyms: V1rh11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171270
Homologene: 110880
Spsb2
Name: splA/ryanodine receptor domain and SOCS box containing 2
Synonyms: SSB2, Grcc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14794
Homologene: 8404
Ighe
Name: Immunoglobulin heavy constant epsilon
Synonyms: LOC380792, Gm900
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380792
HGNC: HGNC:5522
Zfp385a
Name: zinc finger protein 385A
Synonyms: Hzf, Zfp385
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 29813
VEGA: 15
Homologene: 8479
Gdf7
Name: growth differentiation factor 7
Synonyms: BMP12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238057
VEGA: 12
HGNC: HGNC:4222
Homologene: 32177
Tas2r105
Name: taste receptor, type 2, member 105
Synonyms: Tas2r5, T2R05, T2R9, mGR05, mt2r5, T2r5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 57252
Homologene: 69307
Vmn1r232
Name: vomeronasal 1 receptor 232
Synonyms: V1re4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171227
Homologene: 121611
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Tmem229b-ps
Name: transmembrane protein 229B, pseudogene
Synonyms: Gm5423
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432460
VEGA: 10
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 212933
Homologene: 65049
Mief1
Name: mitochondrial elongation factor 1
Synonyms: Smcr7l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239555
VEGA: 15
Homologene: 10374
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 192232
Homologene: 11123
1810062G17Rik
Name: RIKEN cDNA 1810062G17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72282
Nlrp1c-ps
Name: NLR family, pyrin domain containing 1C, pseudogene
Synonyms: Nalp1c, OTTMUSG00000006090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 627984
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,296,996 bp
  • C to T, chromosome 1 at 36,445,181 bp
  • T to A, chromosome 1 at 86,075,997 bp
  • T to A, chromosome 1 at 131,812,114 bp
  • T to A, chromosome 1 at 134,969,298 bp
  • T to C, chromosome 1 at 136,274,868 bp
  • A to T, chromosome 1 at 185,278,281 bp
  • G to A, chromosome 3 at 36,481,806 bp
  • T to G, chromosome 3 at 36,928,551 bp
  • T to A, chromosome 3 at 107,879,372 bp
  • A to T, chromosome 3 at 132,667,492 bp
  • C to T, chromosome 3 at 138,555,458 bp
  • T to C, chromosome 3 at 148,839,636 bp
  • A to G, chromosome 3 at 152,766,514 bp
  • T to C, chromosome 4 at 15,969,393 bp
  • C to T, chromosome 4 at 43,415,212 bp
  • T to A, chromosome 4 at 98,970,904 bp
  • T to C, chromosome 4 at 139,480,652 bp
  • C to T, chromosome 4 at 144,927,188 bp
  • A to G, chromosome 5 at 86,046,586 bp
  • T to A, chromosome 5 at 99,024,805 bp
  • C to A, chromosome 5 at 107,813,545 bp
  • T to A, chromosome 5 at 112,369,476 bp
  • C to T, chromosome 5 at 115,341,430 bp
  • C to T, chromosome 5 at 139,973,316 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 5 at 150,775,354 bp
  • A to G, chromosome 6 at 57,258,284 bp
  • A to T, chromosome 6 at 113,593,291 bp
  • A to T, chromosome 6 at 124,537,394 bp
  • A to G, chromosome 6 at 124,810,376 bp
  • A to T, chromosome 6 at 128,435,802 bp
  • A to C, chromosome 6 at 131,687,402 bp
  • G to A, chromosome 6 at 146,227,524 bp
  • A to T, chromosome 7 at 28,288,022 bp
  • A to G, chromosome 7 at 86,664,603 bp
  • T to A, chromosome 7 at 102,094,573 bp
  • T to A, chromosome 7 at 102,877,685 bp
  • T to G, chromosome 7 at 120,095,177 bp
  • C to G, chromosome 7 at 123,171,046 bp
  • A to G, chromosome 7 at 125,872,956 bp
  • T to C, chromosome 7 at 132,966,696 bp
  • A to T, chromosome 7 at 141,700,875 bp
  • G to A, chromosome 8 at 40,587,037 bp
  • G to A, chromosome 8 at 69,791,360 bp
  • A to G, chromosome 8 at 69,881,694 bp
  • C to A, chromosome 9 at 7,567,534 bp
  • T to C, chromosome 9 at 34,939,198 bp
  • T to C, chromosome 9 at 39,060,099 bp
  • T to C, chromosome 9 at 70,320,066 bp
  • C to A, chromosome 9 at 105,403,502 bp
  • T to A, chromosome 9 at 123,702,186 bp
  • T to A, chromosome 10 at 53,475,199 bp
  • C to A, chromosome 10 at 60,314,227 bp
  • A to G, chromosome 10 at 111,975,569 bp
  • A to G, chromosome 11 at 54,482,503 bp
  • G to A, chromosome 11 at 55,253,827 bp
  • T to A, chromosome 11 at 62,458,682 bp
  • A to T, chromosome 11 at 67,297,164 bp
  • A to T, chromosome 11 at 69,458,358 bp
  • T to C, chromosome 11 at 71,281,225 bp
  • T to C, chromosome 11 at 76,398,801 bp
  • T to A, chromosome 11 at 85,040,004 bp
  • T to C, chromosome 11 at 120,272,778 bp
  • C to T, chromosome 12 at 8,301,729 bp
  • A to G, chromosome 12 at 17,416,101 bp
  • C to A, chromosome 12 at 65,227,214 bp
  • C to T, chromosome 12 at 80,960,447 bp
  • A to G, chromosome 12 at 98,254,230 bp
  • T to A, chromosome 12 at 104,217,323 bp
  • C to A, chromosome 12 at 105,623,992 bp
  • T to A, chromosome 12 at 113,271,488 bp
  • T to G, chromosome 12 at 116,122,810 bp
  • T to G, chromosome 13 at 22,524,447 bp
  • T to G, chromosome 13 at 23,076,208 bp
  • G to A, chromosome 13 at 23,747,128 bp
  • A to T, chromosome 14 at 8,511,021 bp
  • A to G, chromosome 14 at 55,497,123 bp
  • T to C, chromosome 14 at 73,294,993 bp
  • T to C, chromosome 15 at 77,771,947 bp
  • T to C, chromosome 15 at 80,247,925 bp
  • A to T, chromosome 15 at 94,551,806 bp
  • A to T, chromosome 15 at 103,315,810 bp
  • A to G, chromosome 16 at 4,608,711 bp
  • C to T, chromosome 17 at 20,913,339 bp
  • T to A, chromosome 18 at 5,082,773 bp
  • A to G, chromosome 19 at 5,719,283 bp
  • A to G, chromosome 19 at 33,973,546 bp
  • G to A, chromosome 19 at 38,301,235 bp
  • A to G, chromosome 19 at 41,872,937 bp
  • T to C, chromosome X at 57,299,505 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2010 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040019-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.