Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2086Btlr/Mmmh
Stock Number:
040091-MU
Citation ID:
RRID:MMRRC_040091-MU
Other Names:
R2086 (G1), C57BL/6J-MtgxR2086Btlr
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Csnk2a1
Name: casein kinase 2, alpha 1 polypeptide
Synonyms: Csnk2a1-rs4, CK2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12995
Homologene: 90874
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 36,192,414 bp
  • T to A, chromosome 1 at 60,109,411 bp
  • T to A, chromosome 1 at 74,593,967 bp
  • T to A, chromosome 2 at 69,259,476 bp
  • A to G, chromosome 2 at 72,398,385 bp
  • A to C, chromosome 2 at 85,663,746 bp
  • T to C, chromosome 2 at 131,178,597 bp
  • A to G, chromosome 2 at 152,254,281 bp
  • T to C, chromosome 3 at 45,380,471 bp
  • T to C, chromosome 3 at 83,070,588 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to C, chromosome 3 at 98,102,367 bp
  • T to C, chromosome 4 at 55,010,830 bp
  • T to A, chromosome 4 at 63,550,067 bp
  • A to G, chromosome 4 at 86,228,012 bp
  • A to T, chromosome 4 at 106,735,563 bp
  • T to C, chromosome 4 at 133,872,969 bp
  • A to C, chromosome 5 at 30,863,202 bp
  • A to G, chromosome 5 at 64,980,059 bp
  • A to T, chromosome 5 at 76,532,846 bp
  • T to C, chromosome 5 at 89,438,342 bp
  • C to T, chromosome 5 at 108,445,621 bp
  • T to A, chromosome 6 at 40,761,028 bp
  • A to G, chromosome 6 at 48,977,602 bp
  • T to C, chromosome 6 at 83,757,852 bp
  • C to T, chromosome 6 at 88,012,318 bp
  • T to G, chromosome 6 at 90,344,114 bp
  • T to C, chromosome 6 at 139,494,834 bp
  • C to A, chromosome 6 at 140,570,318 bp
  • A to G, chromosome 7 at 15,833,607 bp
  • T to G, chromosome 7 at 26,312,308 bp
  • C to T, chromosome 7 at 28,277,773 bp
  • C to A, chromosome 7 at 65,312,921 bp
  • A to C, chromosome 7 at 112,318,603 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • T to A, chromosome 7 at 125,219,706 bp
  • T to C, chromosome 7 at 125,318,595 bp
  • T to A, chromosome 8 at 105,888,002 bp
  • A to G, chromosome 9 at 13,799,952 bp
  • C to T, chromosome 9 at 67,950,289 bp
  • G to A, chromosome 9 at 110,634,071 bp
  • A to T, chromosome 10 at 61,423,298 bp
  • T to A, chromosome 10 at 80,057,856 bp
  • A to G, chromosome 11 at 5,059,431 bp
  • T to C, chromosome 11 at 59,078,256 bp
  • G to C, chromosome 11 at 69,760,946 bp
  • T to G, chromosome 11 at 83,351,118 bp
  • A to G, chromosome 11 at 87,035,268 bp
  • C to T, chromosome 12 at 28,594,787 bp
  • A to G, chromosome 12 at 98,805,496 bp
  • T to C, chromosome 12 at 100,619,615 bp
  • A to T, chromosome 12 at 103,675,262 bp
  • G to T, chromosome 12 at 118,113,871 bp
  • G to A, chromosome 13 at 59,645,185 bp
  • A to G, chromosome 13 at 64,794,262 bp
  • A to G, chromosome 13 at 66,953,555 bp
  • G to A, chromosome 14 at 19,778,043 bp
  • T to C, chromosome 14 at 30,047,357 bp
  • C to T, chromosome 14 at 30,937,843 bp
  • T to A, chromosome 14 at 50,140,123 bp
  • T to A, chromosome 14 at 55,743,659 bp
  • T to G, chromosome 14 at 56,483,380 bp
  • T to C, chromosome 14 at 122,686,115 bp
  • T to C, chromosome 14 at 123,371,623 bp
  • T to C, chromosome 15 at 31,594,203 bp
  • T to C, chromosome 15 at 36,227,141 bp
  • A to G, chromosome 15 at 85,121,851 bp
  • T to A, chromosome 15 at 85,838,727 bp
  • T to C, chromosome 16 at 20,338,966 bp
  • T to A, chromosome 16 at 30,352,298 bp
  • C to G, chromosome 16 at 31,110,945 bp
  • T to A, chromosome 16 at 34,995,060 bp
  • A to G, chromosome 16 at 45,144,265 bp
  • T to C, chromosome 17 at 6,956,703 bp
  • T to G, chromosome 17 at 19,676,687 bp
  • A to T, chromosome 17 at 20,777,193 bp
  • T to C, chromosome 17 at 24,217,900 bp
  • T to C, chromosome 17 at 34,802,052 bp
  • T to A, chromosome 17 at 48,316,782 bp
  • T to C, chromosome 17 at 49,715,163 bp
  • T to C, chromosome 17 at 56,454,984 bp
  • T to C, chromosome 17 at 67,817,623 bp
  • T to A, chromosome 18 at 3,288,098 bp
  • T to C, chromosome 18 at 10,523,281 bp
  • T to A, chromosome 18 at 12,524,830 bp
  • A to G, chromosome 18 at 77,384,946 bp
  • G to A, chromosome 19 at 6,391,481 bp
  • A to G, chromosome 19 at 10,723,256 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2086 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040091-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.