Strain Name:
C57BL/6J-MtgxR2086Btlr/Mmmh
Stock Number:
040091-MU
Citation ID:
RRID:MMRRC_040091-MU
Other Names:
R2086 (G1), C57BL/6J-MtgxR2086Btlr
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Csnk2a1
Name: casein kinase 2, alpha 1 polypeptide
Synonyms: CK2, Csnk2a1-rs4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12995
HGNC: HGNC:2457
Homologene: 90874
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, D130023A07Rik, Tnrc6, 3110054G10Rik, 2010321I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233833
Homologene: 41399
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20111
Homologene: 55703
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, Zfpip, 9430078C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242466
Homologene: 41430
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 109135
Homologene: 10377
Rps6ka5
Name: ribosomal protein S6 kinase, polypeptide 5
Synonyms: 6330404E13Rik, 3110005L17Rik, MSK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73086
VEGA: 12
Homologene: 48302
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: B230120H23Rik, Zak, MLTKalpha, MLTKbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65964
Homologene: 32331
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Abcc5
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms: 2900011L11Rik, Mrp5, Abcc5b, Abcc5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Mtmr2
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77116
HGNC: HGNC:7450
Homologene: 22951
Nodal
Name: nodal
Synonyms: Tg.413d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18119
HGNC: HGNC:7865
Homologene: 8417
Tjp1
Name: tight junction protein 1
Synonyms: ZO1, ZO-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21872
Homologene: 2445
Atp13a3
Name: ATPase type 13A3
Synonyms: LOC385637, LOC224087, LOC224088
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224088
Homologene: 23455
Rab7
Name: RAB7, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19349
HGNC: HGNC:9788
Homologene: 3408
Atp6v1b1
Name: ATPase, H+ transporting, lysosomal V1 subunit B1
Synonyms: lysosomal 56/58kDa, Vpp-3, Vpp3, Atp6b1, D630039P21Rik, D630030L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110935
HGNC: HGNC:853
Homologene: 68198
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 5930437A14Rik, 6720426B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
Fam151a
Name: family with sequence simliarity 151, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230579
Homologene: 17143
Slc49a3
Name: solute carrier family 49 member 3
Synonyms: 4732482E20Rik, Mfsd7, Mfsd7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243197
VEGA: 5
Homologene: 49990
Pcca
Name: propionyl-Coenzyme A carboxylase, alpha polypeptide
Synonyms: C79630
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110821
HGNC: HGNC:8653
Homologene: 236
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: Ptpt9, PTP-NU3, PTPsigma, RPTPsigma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Cct5
Name: chaperonin containing Tcp1, subunit 5 (epsilon)
Synonyms: Ccte, TCPE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12465
HGNC: HGNC:1618
Homologene: 6287
Nid2
Name: nidogen 2
Synonyms: entactin 2, entactin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18074
VEGA: 14
Homologene: 40575
Kirrel
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170643
Homologene: 10089
Atp6v1g1
Name: ATPase, H+ transporting, lysosomal V1 subunit G1
Synonyms: lysosomal 13kDa, Atp6g1, 1810024D14Rik, Vma10, VAG1, ATP6J
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66290
HGNC: HGNC:864
Homologene: 31272
Golm1
Name: golgi membrane protein 1
Synonyms: Golph2, D030064E01Rik, 2310001L02Rik, GP73, PSEC0257
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: C820010P03Rik, A930007H10Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320011
Homologene: 10586
Exoc1
Name: exocyst complex component 1
Synonyms: A730011E05Rik, Sec3l1, 2810407P21Rik, SEC3, Sec3p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69940
Homologene: 41241
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234699
Homologene: 40937
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1727Clo, b2b1289Clo, b2b1203Clo, b2b1279Clo, avc4, lrd, b2b598Clo, Dnahc11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: sba, 1700096C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240411
Lama3
Name: laminin, alpha 3
Synonyms: [a]3B, nicein, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: C79217, 8430418G19Rik, Cav1.3alpha1, Cchl1a2, Cchl1a, Cacnl1a2, D-LTCC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18526
Homologene: 74967
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: ABC16, PFIC2, Bsep, Lith1, sister of P-glycoprotein, PGY4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Uroc1
Name: urocanase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243537
Homologene: 76629
Ttc38
Name: tetratricopeptide repeat domain 38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239570
Homologene: 41208
Vmn2r102
Name: vomeronasal 2, receptor 102
Synonyms: EG224572
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224572
Homologene: 115024
Kif6
Name: kinesin family member 6
Synonyms: D130004B10Rik, D130084M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 319991
Homologene: 35308
Obox6
Name: oocyte specific homeobox 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252830
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: Itih-1, Intin1, inter-alpha (globulin) inhibitor, H1 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: Smc1l2, SMC1beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171226
Homologene: 74320
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: AK220484, mKIAA4095
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Mical2
Name: microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms: 5330438E18Rik, Micalcl, 4921517J23Rik, Ebitein1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320878
Homologene: 8760
Dhrs1
Name: dehydrogenase/reductase (SDR family) member 1
Synonyms: 1110029G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 52585
Homologene: 41696
Mylk
Name: myosin, light polypeptide kinase
Synonyms: 9530072E15Rik, Mlck, nmMlck, A930019C19Rik, telokin, MLCK108, MLCK210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Cenpb
Name: centromere protein B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
4930533L02Rik
Name: RIKEN cDNA 4930533L02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Aoc1l1
Name: amine oxidase copper containing 1-like 1
Synonyms: Doxl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243376
HGNC: HGNC:80
Homologene: 19443
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Pygm
Name: muscle glycogen phosphorylase
Synonyms: PG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19309
HGNC: HGNC:9726
Homologene: 2145
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PSS-1, PtdSer Synthase-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Carf
Name: calcium response factor
Synonyms: Als2cr8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241066
Homologene: 11689
Cyp2a4
Name: cytochrome P450, family 2, subfamily a, polypeptide 4
Synonyms: testosterone 15alpha-hydroxylase, Cyp15a1, D7Ucla4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13086
Homologene: 85917
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: 21-hydroxylase, 21-OH, 21OHA, Oh21-1, 21OH, Oh21-1, Cyp21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13079
Homologene: 68063
Rergl
Name: RERG/RAS-like
Synonyms: EG632971
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 632971
Homologene: 41583
Gc
Name: vitamin D binding protein
Synonyms: DBP, vitamin D binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14473
HGNC: HGNC:4187
Homologene: 486
Cd5
Name: CD5 antigen
Synonyms: Lyt-1, Ly-A, Ly-12, Ly-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12507
VEGA: 19
HGNC: HGNC:1685
Homologene: 7260
Plrg1
Name: pleiotropic regulator 1
Synonyms: Tango4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53317
HGNC: HGNC:9089
Homologene: 2004
Tedc2
Name: tubulin epsilon and delta complex 2
Synonyms: 1600002H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72016
Homologene: 45943
Spag1
Name: sperm associated antigen 1
Synonyms: tpis, TPR-containing protein involved in spermatogenesis
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 26942
VEGA: 15
Homologene: 8081
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66569
Homologene: 7069
Fam114a1
Name: family with sequence similarity 114, member A1
Synonyms: 1190001N04Rik, 9130005N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68303
Homologene: 12259
Mapre3
Name: microtubule-associated protein, RP/EB family, member 3
Synonyms: EB3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100732
HGNC: HGNC:6892
Homologene: 56565
Tagap1
Name: T cell activation GTPase activating protein 1
Synonyms: 2610315E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 380608
VEGA: 17
Slc35a5
Name: solute carrier family 35, member A5
Synonyms: 1010001J06Rik, D730043G07Rik, D16Ertd450e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74102
Homologene: 9930
Rnf25
Name: ring finger protein 25
Synonyms: 0610009H16Rik, AO7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57751
Homologene: 11193
Or4k1
Name: olfactory receptor family 4 subfamily K member 1
Synonyms: MOR246-1P, GA_x6K02T2PMLR-5831021-5830086, Olfr728
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258039
Homologene: 74224
Slc35g3
Name: solute carrier family 35, member G3
Synonyms: Amac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56293
Homologene: 89413
Rasl10a
Name: RAS-like, family 10, member A
Synonyms: 2210403B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75668
Homologene: 4732
B430306N03Rik
Name: RIKEN cDNA B430306N03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320148
Homologene: 138443
Or5g26
Name: olfactory receptor family 5 subfamily G member 26
Synonyms: OR93, Olfr154, MOR175-1, GA_x6K02T2Q125-47143827-47142871, Olfr4-3, 912-93
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27216
Homologene: 104131
Eid2b
Name: EP300 interacting inhibitor of differentiation 2B
Synonyms: 3010005C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434156
Homologene: 51846
Gm6252
Name: predicted gene 6252
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 621699
VEGA: 19
Serpina16
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16
Synonyms: Gm46, LOC194604
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 194604
Homologene: 52303
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 36,192,414 bp
  • T to A, chromosome 1 at 60,109,411 bp
  • T to A, chromosome 1 at 74,593,967 bp
  • T to A, chromosome 2 at 69,259,476 bp
  • A to G, chromosome 2 at 72,398,385 bp
  • A to C, chromosome 2 at 85,663,746 bp
  • T to C, chromosome 2 at 131,178,597 bp
  • A to G, chromosome 2 at 152,254,281 bp
  • T to C, chromosome 3 at 45,380,471 bp
  • T to C, chromosome 3 at 83,070,588 bp
  • C to T, chromosome 3 at 87,089,151 bp
  • T to C, chromosome 3 at 98,102,367 bp
  • T to C, chromosome 4 at 55,010,830 bp
  • T to A, chromosome 4 at 63,550,067 bp
  • A to G, chromosome 4 at 86,228,012 bp
  • A to T, chromosome 4 at 106,735,563 bp
  • T to C, chromosome 4 at 133,872,969 bp
  • A to C, chromosome 5 at 30,863,202 bp
  • A to G, chromosome 5 at 64,980,059 bp
  • A to T, chromosome 5 at 76,532,846 bp
  • T to C, chromosome 5 at 89,438,342 bp
  • C to T, chromosome 5 at 108,445,621 bp
  • T to A, chromosome 6 at 40,761,028 bp
  • A to G, chromosome 6 at 48,977,602 bp
  • T to C, chromosome 6 at 83,757,852 bp
  • C to T, chromosome 6 at 88,012,318 bp
  • T to G, chromosome 6 at 90,344,114 bp
  • T to C, chromosome 6 at 139,494,834 bp
  • C to A, chromosome 6 at 140,570,318 bp
  • A to G, chromosome 7 at 15,833,607 bp
  • T to G, chromosome 7 at 26,312,308 bp
  • C to T, chromosome 7 at 28,277,773 bp
  • C to A, chromosome 7 at 65,312,921 bp
  • A to C, chromosome 7 at 112,318,603 bp
  • CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT, chromosome 7 at 123,162,446 bp
  • T to A, chromosome 7 at 125,219,706 bp
  • T to C, chromosome 7 at 125,318,595 bp
  • T to A, chromosome 8 at 105,888,002 bp
  • A to G, chromosome 9 at 13,799,952 bp
  • C to T, chromosome 9 at 67,950,289 bp
  • G to A, chromosome 9 at 110,634,071 bp
  • A to T, chromosome 10 at 61,423,298 bp
  • T to A, chromosome 10 at 80,057,856 bp
  • A to G, chromosome 11 at 5,059,431 bp
  • T to C, chromosome 11 at 59,078,256 bp
  • G to C, chromosome 11 at 69,760,946 bp
  • T to G, chromosome 11 at 83,351,118 bp
  • A to G, chromosome 11 at 87,035,268 bp
  • C to T, chromosome 12 at 28,594,787 bp
  • A to G, chromosome 12 at 98,805,496 bp
  • T to C, chromosome 12 at 100,619,615 bp
  • A to T, chromosome 12 at 103,675,262 bp
  • G to T, chromosome 12 at 118,113,871 bp
  • G to A, chromosome 13 at 59,645,185 bp
  • A to G, chromosome 13 at 64,794,262 bp
  • A to G, chromosome 13 at 66,953,555 bp
  • G to A, chromosome 14 at 19,778,043 bp
  • T to C, chromosome 14 at 30,047,357 bp
  • C to T, chromosome 14 at 30,937,843 bp
  • T to A, chromosome 14 at 50,140,123 bp
  • T to A, chromosome 14 at 55,743,659 bp
  • T to G, chromosome 14 at 56,483,380 bp
  • T to C, chromosome 14 at 122,686,115 bp
  • T to C, chromosome 14 at 123,371,623 bp
  • T to C, chromosome 15 at 31,594,203 bp
  • T to C, chromosome 15 at 36,227,141 bp
  • A to G, chromosome 15 at 85,121,851 bp
  • T to A, chromosome 15 at 85,838,727 bp
  • T to C, chromosome 16 at 20,338,966 bp
  • T to A, chromosome 16 at 30,352,298 bp
  • C to G, chromosome 16 at 31,110,945 bp
  • T to A, chromosome 16 at 34,995,060 bp
  • A to G, chromosome 16 at 45,144,265 bp
  • T to C, chromosome 17 at 6,956,703 bp
  • T to G, chromosome 17 at 19,676,687 bp
  • A to T, chromosome 17 at 20,777,193 bp
  • T to C, chromosome 17 at 24,217,900 bp
  • T to C, chromosome 17 at 34,802,052 bp
  • T to A, chromosome 17 at 48,316,782 bp
  • T to C, chromosome 17 at 49,715,163 bp
  • T to C, chromosome 17 at 56,454,984 bp
  • T to C, chromosome 17 at 67,817,623 bp
  • T to A, chromosome 18 at 3,288,098 bp
  • T to C, chromosome 18 at 10,523,281 bp
  • T to A, chromosome 18 at 12,524,830 bp
  • A to G, chromosome 18 at 77,384,946 bp
  • G to A, chromosome 19 at 6,391,481 bp
  • A to G, chromosome 19 at 10,723,256 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2086 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040091-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.