MMRRC:040144-MU

C to T, chromosome 1 at 7,169,565 bp
T to A, chromosome 1 at 46,268,670 bp
G to A, chromosome 1 at 75,486,756 bp
T to C, chromosome 1 at 89,837,755 bp
T to C, chromosome 1 at 111,859,457 bp
CAT to CATTAT, chromosome 1 at 115,900,919 bp
C to T, chromosome 1 at 130,449,423 bp
G to A, chromosome 1 at 132,596,645 bp
AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
C to G, chromosome 1 at 133,350,778 bp
A to T, chromosome 1 at 133,903,796 bp
C to T, chromosome 1 at 133,915,131 bp
ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
AG to AGG, chromosome 1 at 134,971,364 bp
ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
A to G, chromosome 1 at 135,402,250 bp
TG to TGG, chromosome 1 at 135,846,761 bp
AGGG to AGG, chromosome 1 at 135,974,852 bp
C to T, chromosome 1 at 136,152,264 bp
CC to CCGAC, chromosome 1 at 136,490,395 bp
T to G, chromosome 1 at 139,831,155 bp
T to C, chromosome 1 at 143,760,034 bp
T to A, chromosome 1 at 170,329,166 bp
T to C, chromosome 1 at 185,410,249 bp
T to A, chromosome 1 at 191,604,860 bp
A to G, chromosome 2 at 25,362,857 bp
A to G, chromosome 2 at 31,600,557 bp
T to C, chromosome 2 at 84,840,961 bp
A to G, chromosome 2 at 85,918,827 bp
T to A, chromosome 2 at 87,489,977 bp
A to G, chromosome 2 at 88,275,010 bp
A to G, chromosome 2 at 91,647,849 bp
T to C, chromosome 2 at 103,731,303 bp
T to A, chromosome 2 at 109,333,503 bp
A to T, chromosome 2 at 111,483,630 bp
G to A, chromosome 2 at 135,976,099 bp
T to A, chromosome 3 at 88,576,642 bp
A to T, chromosome 3 at 88,887,595 bp
G to A, chromosome 4 at 118,472,811 bp
A to G, chromosome 4 at 129,548,920 bp
A to G, chromosome 4 at 134,229,628 bp
C to T, chromosome 4 at 139,477,207 bp
A to G, chromosome 4 at 148,024,137 bp
A to G, chromosome 5 at 6,772,583 bp
T to C, chromosome 5 at 112,874,026 bp
T to C, chromosome 5 at 115,470,950 bp
A to G, chromosome 5 at 123,523,361 bp
A to C, chromosome 5 at 137,957,546 bp
A to G, chromosome 5 at 144,147,615 bp
A to T, chromosome 5 at 150,647,536 bp
A to G, chromosome 6 at 29,448,675 bp
A to G, chromosome 6 at 113,549,321 bp
A to T, chromosome 6 at 121,031,134 bp
T to C, chromosome 6 at 132,737,358 bp
A to G, chromosome 6 at 133,529,275 bp
A to G, chromosome 7 at 19,524,237 bp
T to C, chromosome 7 at 29,531,510 bp
T to C, chromosome 7 at 44,733,077 bp
C to A, chromosome 7 at 55,997,511 bp
T to A, chromosome 7 at 106,329,956 bp
A to C, chromosome 7 at 120,407,474 bp
G to T, chromosome 7 at 125,219,453 bp
A to G, chromosome 7 at 126,797,642 bp
G to A, chromosome 7 at 127,582,214 bp
A to G, chromosome 7 at 135,695,592 bp
C to A, chromosome 8 at 25,022,658 bp
T to C, chromosome 8 at 119,876,772 bp
G to A, chromosome 8 at 124,605,711 bp
G to A, chromosome 8 at 125,491,491 bp
T to A, chromosome 9 at 63,616,675 bp
T to A, chromosome 9 at 80,123,820 bp
A to G, chromosome 9 at 87,715,653 bp
A to G, chromosome 9 at 99,296,385 bp
C to T, chromosome 9 at 107,658,762 bp
A to G, chromosome 9 at 108,565,347 bp
G to A, chromosome 9 at 119,964,295 bp
C to A, chromosome 10 at 14,770,442 bp
G to T, chromosome 10 at 34,127,695 bp
T to C, chromosome 10 at 39,848,049 bp
G to T, chromosome 10 at 62,990,994 bp
A to T, chromosome 10 at 120,106,021 bp
A to G, chromosome 10 at 127,336,727 bp
A to G, chromosome 10 at 127,563,804 bp
A to G, chromosome 10 at 128,123,612 bp
A to G, chromosome 10 at 129,133,006 bp
A to T, chromosome 11 at 20,698,318 bp
G to T, chromosome 11 at 58,423,926 bp
C to A, chromosome 11 at 60,189,467 bp
CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
G to C, chromosome 11 at 76,211,050 bp
G to A, chromosome 11 at 78,540,034 bp
A to G, chromosome 11 at 80,814,332 bp
A to T, chromosome 11 at 87,583,436 bp
A to G, chromosome 11 at 102,287,553 bp
T to C, chromosome 13 at 69,738,664 bp
T to A, chromosome 13 at 77,049,219 bp
T to C, chromosome 14 at 34,091,916 bp
A to G, chromosome 15 at 25,714,108 bp
T to C, chromosome 15 at 31,609,572 bp
T to C, chromosome 15 at 65,995,851 bp
A to T, chromosome 15 at 76,632,661 bp
G to A, chromosome 16 at 97,538,703 bp
A to G, chromosome 17 at 17,087,884 bp
T to A, chromosome 17 at 24,334,266 bp
T to A, chromosome 17 at 74,447,951 bp
A to G, chromosome 18 at 10,574,873 bp
A to G, chromosome 18 at 40,259,178 bp
T to C, chromosome 18 at 84,094,543 bp
T to G, chromosome 19 at 29,022,847 bp
G to A, chromosome 19 at 34,878,980 bp
T to A, chromosome X at 23,907,310 bp
A to G, chromosome X at 99,147,517 bp
G to A, chromosome X at 135,802,042 bp
G to T, chromosome X at 151,862,641 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R2141 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
040144-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All