Strain Name:
Stock Number:
Citation ID:
Other Names:
R2141 (G1), C57BL/6J-MtgxR2141Btlr
Major Collection:

Strain Information

Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17909
Homologene: 36328
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14632
VEGA: 10
Homologene: 3859
Name: ephrin B1
Synonyms: Stra1, LERK-2, Cek5 ligand, Epl2, Cek5-L, EFL-3, Elk-L, Eplg2, Lerk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
Homologene: 3263
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68121
Homologene: 11387
Name: gon-4-like (C.elegans)
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76022
Homologene: 13002
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320267
Homologene: 45954
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 347722
Homologene: 56689
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211651
Homologene: 13212
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18798
Homologene: 8471
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26372
Homologene: 985
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 215351
Homologene: 9196
Name: glutamyl-prolyl-tRNA synthetase
Synonyms: 3010002K18Rik, 2410081F06Rik, Qprs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107508
Homologene: 5870
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 117599
Homologene: 50463
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 116848
VEGA: 10
Homologene: 8393
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194401
Homologene: 85288
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Synonyms: 8430411F12Rik, A030012M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319263
Homologene: 14180
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
Homologene: 1814
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228421
Homologene: 41820
Name: lymphocyte protein tyrosine kinase
Synonyms: Hck-3, p56lck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16818
Homologene: 3911
Name: HECT, UBA and WWE domain containing 1
Synonyms: Ib772, 5430439H10Rik, LOC382250, Ureb1, C430014N20Rik, Mule, Arf-bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 59026
Homologene: 45994
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72749
Homologene: 22754
Name: N-acetyltransferase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98956
Homologene: 6785
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105377
Homologene: 13000
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: aldolase A, fructose-bisphosphate
Synonyms: Aldo-1, Aldo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11674
Homologene: 123896
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf-GPI, complement-glycosylphosphatidylinositol, GPI-DAF, Cromer blood group, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
Homologene: 479
Name: aftiphilin
Synonyms: 9130023F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216549
Homologene: 9764
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23918
Homologene: 48919
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Name: G protein-coupled receptor associated sorting protein 1
Synonyms: 3110031O14Rik, GASP1, 2210415K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 67298
Homologene: 8809
Name: zinc finger protein 960
Synonyms: BC018101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 449000
Homologene: 133884
Name: ATP-binding cassette, sub-family A (ABC1), member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381072
Homologene: 86807
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381410
Homologene: 11687
Name: neuromedin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18101
Homologene: 20560
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: diablo, IAP-binding mitochondrial protein
Synonyms: 0610041G12Rik, Smac, 1700006L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 66593
Homologene: 10532
Name: alpha- and gamma-adaptin binding protein
Synonyms: 2310007F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66939
Homologene: 11648
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77065
Homologene: 9136
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 77805
Homologene: 62166
Name: zinc finger protein 473
Synonyms: D030014N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243963
Homologene: 18698
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Name: transmembrane protein 98
Synonyms: 6530411B15Rik, Rwhs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103743
Homologene: 9185
Name: transmembrane and ubiquitin-like domain containing 2
Synonyms: 2010008E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72053
Homologene: 18581
Name: retinoic acid induced 1
Synonyms: Gt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19377
Homologene: 7508
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Name: calcium homeostasis modulator family member 6
Synonyms: A630077B13Rik, Fam26f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215900
VEGA: 10
Homologene: 25235
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
Homologene: 1744
Name: WD repeat domain 87, pseudogene
Synonyms: 4932431P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69547
Homologene: 18876
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320631
Homologene: 87255
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Name: RIKEN cDNA 1810065E05 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69864
Homologene: 87042
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21846
Homologene: 3957
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19714
Homologene: 48147
Name: RUN and FYVE domain-containing 2
Synonyms: LZ-FYVE, 2610111M19Rik, Denn, ZFYVE13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70432
Homologene: 23064
Name: RNA transcription, translation and transport factor, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 545536
Name: annexin A8
Synonyms: Anx8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11752
Homologene: 20393
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70729
Homologene: 135990
Name: olfactory receptor family 5 subfamily M member 13
Synonyms: GA_x6K02T2Q125-47397266-47398205, MOR196-6_p, MOR196-5P, Olfr1025
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258083
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: potassium channel tetramerisation domain containing 16
Synonyms: 4930434H12Rik, LOC383347, 2900055J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 383348
VEGA: 18
Homologene: 44779
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
Homologene: 37481
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76365
Homologene: 11384
Name: gap junction protein, gamma 3
Synonyms: connexin 29, Cx29, Gje1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 118446
Homologene: 15399
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244668
Homologene: 18956
Name: ubiquitin-conjugating enzyme E2Q family-like 1
Synonyms: 3110006E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76980
VEGA: 13
Homologene: 15975
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16565
Homologene: 56868
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269116
Homologene: 24945
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17858
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74376
Homologene: 53435
Name: adenylate kinase 3
Synonyms: AK-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56248
Homologene: 21744
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73647
Homologene: 38208
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 636808
Homologene: 43974
Name: phosphorylase kinase, gamma 2 (testis)
Synonyms: 1500017I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68961
Homologene: 47915
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110862
Homologene: 20949
Name: pantothenate kinase 1
Synonyms: 5430426F23Rik, Pank1b, Pank1a, Pank1, 4632412I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 75735
VEGA: 19
Homologene: 56979
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Name: ATP synthase C subunit lysine N-methyltransferase
Synonyms: A930016P21Rik, Fam173b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68073
Homologene: 16780
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69742
Homologene: 12328
Name: kelch-like 36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234796
Homologene: 32598
Name: taste receptor, type 2, member 115
Synonyms: Tas2r15, mGR15, mt2r49, T2R15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353325
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
Name: olfactory receptor family 5 subfamily D member 43
Synonyms: GA_x6K02T2Q125-49759783-49758845, MOR174-20_p, Olfr1173
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404329
Homologene: 128091
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Name: UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227620
Homologene: 71313
Name: solute carrier family 38, member 3
Synonyms: 0610012J02Rik, D9Ucla2, Snat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76257
Homologene: 4983
Name: prostaglandin reductase 3
Synonyms: C530046K17Rik, Pthr3, Zadh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225791
VEGA: 18
Homologene: 38387
Name: NEDD4 binding protein 2-like 2
Synonyms: 2700092H06Rik, zag1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381695
Homologene: 115380
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: olfactory receptor family 6 subfamily C member 201
Synonyms: GA_x6K02T2PULF-10819232-10818297, MOR114-5, Olfr770
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258862
Homologene: 27285
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194231
Homologene: 4604
Name: testin LIM domain protein like 1
Synonyms: Gm4907
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236749
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: olfactory receptor family 4 subfamily F member 4B
Synonyms: GA_x6K02T2Q125-72534883-72535821, MOR245-6, Olfr1289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258399
Name: non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Synonyms: A830014A18Rik, Spg6, 1110027G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233280
Homologene: 42327
Name: solute carrier family 43, member 1
Synonyms: PB39, 2610016F07Rik, Pov1, Lat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72401
Homologene: 2688
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 280287
Homologene: 1701
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Name: predicted gene 6252
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 621699
VEGA: 19
Name: phospholipase A2, group IB, pancreas
Synonyms: Pla2a, sPLA2IB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18778
Homologene: 715
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 7,169,565 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 89,837,755 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 132,596,645 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 136,152,264 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 170,329,166 bp
  • T to C, chromosome 1 at 185,410,249 bp
  • T to A, chromosome 1 at 191,604,860 bp
  • A to G, chromosome 2 at 25,362,857 bp
  • A to G, chromosome 2 at 31,600,557 bp
  • T to C, chromosome 2 at 84,840,961 bp
  • A to G, chromosome 2 at 85,918,827 bp
  • T to A, chromosome 2 at 87,489,977 bp
  • A to G, chromosome 2 at 88,275,010 bp
  • A to G, chromosome 2 at 91,647,849 bp
  • T to C, chromosome 2 at 103,731,303 bp
  • T to A, chromosome 2 at 109,333,503 bp
  • A to T, chromosome 2 at 111,483,630 bp
  • G to A, chromosome 2 at 135,976,099 bp
  • T to A, chromosome 3 at 88,576,642 bp
  • A to T, chromosome 3 at 88,887,595 bp
  • G to A, chromosome 4 at 118,472,811 bp
  • A to G, chromosome 4 at 129,548,920 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • A to G, chromosome 5 at 6,772,583 bp
  • T to C, chromosome 5 at 112,874,026 bp
  • T to C, chromosome 5 at 115,470,950 bp
  • A to G, chromosome 5 at 123,523,361 bp
  • A to C, chromosome 5 at 137,957,546 bp
  • A to G, chromosome 5 at 144,147,615 bp
  • A to T, chromosome 5 at 150,647,536 bp
  • A to G, chromosome 6 at 29,448,675 bp
  • A to G, chromosome 6 at 113,549,321 bp
  • A to T, chromosome 6 at 121,031,134 bp
  • T to C, chromosome 6 at 132,737,358 bp
  • A to G, chromosome 6 at 133,529,275 bp
  • A to G, chromosome 7 at 19,524,237 bp
  • T to C, chromosome 7 at 29,531,510 bp
  • T to C, chromosome 7 at 44,733,077 bp
  • C to A, chromosome 7 at 55,997,511 bp
  • T to A, chromosome 7 at 106,329,956 bp
  • A to C, chromosome 7 at 120,407,474 bp
  • G to T, chromosome 7 at 125,219,453 bp
  • A to G, chromosome 7 at 126,797,642 bp
  • G to A, chromosome 7 at 127,582,214 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • C to A, chromosome 8 at 25,022,658 bp
  • T to C, chromosome 8 at 119,876,772 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • G to A, chromosome 8 at 125,491,491 bp
  • T to A, chromosome 9 at 63,616,675 bp
  • T to A, chromosome 9 at 80,123,820 bp
  • A to G, chromosome 9 at 87,715,653 bp
  • A to G, chromosome 9 at 99,296,385 bp
  • C to T, chromosome 9 at 107,658,762 bp
  • A to G, chromosome 9 at 108,565,347 bp
  • G to A, chromosome 9 at 119,964,295 bp
  • C to A, chromosome 10 at 14,770,442 bp
  • G to T, chromosome 10 at 34,127,695 bp
  • T to C, chromosome 10 at 39,848,049 bp
  • G to T, chromosome 10 at 62,990,994 bp
  • A to T, chromosome 10 at 120,106,021 bp
  • A to G, chromosome 10 at 127,336,727 bp
  • A to G, chromosome 10 at 127,563,804 bp
  • A to G, chromosome 10 at 128,123,612 bp
  • A to G, chromosome 10 at 129,133,006 bp
  • A to T, chromosome 11 at 20,698,318 bp
  • G to T, chromosome 11 at 58,423,926 bp
  • C to A, chromosome 11 at 60,189,467 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 80,814,332 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 102,287,553 bp
  • T to C, chromosome 13 at 69,738,664 bp
  • T to A, chromosome 13 at 77,049,219 bp
  • T to C, chromosome 14 at 34,091,916 bp
  • A to G, chromosome 15 at 25,714,108 bp
  • T to C, chromosome 15 at 31,609,572 bp
  • T to C, chromosome 15 at 65,995,851 bp
  • A to T, chromosome 15 at 76,632,661 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • A to G, chromosome 17 at 17,087,884 bp
  • T to A, chromosome 17 at 24,334,266 bp
  • T to A, chromosome 17 at 74,447,951 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • T to C, chromosome 18 at 84,094,543 bp
  • T to G, chromosome 19 at 29,022,847 bp
  • G to A, chromosome 19 at 34,878,980 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
  • G to T, chromosome X at 151,862,641 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2141 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040144-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.