Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2141Btlr/Mmmh
Stock Number:
040144-MU
Citation ID:
RRID:MMRRC_040144-MU
Other Names:
R2141 (G1), C57BL/6J-MtgxR2141Btlr
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Efnb1
Name: ephrin B1
Synonyms: Stra1, LERK-2, Cek5 ligand, Epl2, Cek5-L, EFL-3, Elk-L, Eplg2, Lerk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Cep70
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68121
Homologene: 11387
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 7,169,565 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 89,837,755 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 132,596,645 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 136,152,264 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 170,329,166 bp
  • T to C, chromosome 1 at 185,410,249 bp
  • T to A, chromosome 1 at 191,604,860 bp
  • A to G, chromosome 2 at 25,362,857 bp
  • A to G, chromosome 2 at 31,600,557 bp
  • T to C, chromosome 2 at 84,840,961 bp
  • A to G, chromosome 2 at 85,918,827 bp
  • T to A, chromosome 2 at 87,489,977 bp
  • A to G, chromosome 2 at 88,275,010 bp
  • A to G, chromosome 2 at 91,647,849 bp
  • T to C, chromosome 2 at 103,731,303 bp
  • T to A, chromosome 2 at 109,333,503 bp
  • A to T, chromosome 2 at 111,483,630 bp
  • G to A, chromosome 2 at 135,976,099 bp
  • T to A, chromosome 3 at 88,576,642 bp
  • A to T, chromosome 3 at 88,887,595 bp
  • G to A, chromosome 4 at 118,472,811 bp
  • A to G, chromosome 4 at 129,548,920 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • A to G, chromosome 5 at 6,772,583 bp
  • T to C, chromosome 5 at 112,874,026 bp
  • T to C, chromosome 5 at 115,470,950 bp
  • A to G, chromosome 5 at 123,523,361 bp
  • A to C, chromosome 5 at 137,957,546 bp
  • A to G, chromosome 5 at 144,147,615 bp
  • A to T, chromosome 5 at 150,647,536 bp
  • A to G, chromosome 6 at 29,448,675 bp
  • A to G, chromosome 6 at 113,549,321 bp
  • A to T, chromosome 6 at 121,031,134 bp
  • T to C, chromosome 6 at 132,737,358 bp
  • A to G, chromosome 6 at 133,529,275 bp
  • A to G, chromosome 7 at 19,524,237 bp
  • T to C, chromosome 7 at 29,531,510 bp
  • T to C, chromosome 7 at 44,733,077 bp
  • C to A, chromosome 7 at 55,997,511 bp
  • T to A, chromosome 7 at 106,329,956 bp
  • A to C, chromosome 7 at 120,407,474 bp
  • G to T, chromosome 7 at 125,219,453 bp
  • A to G, chromosome 7 at 126,797,642 bp
  • G to A, chromosome 7 at 127,582,214 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • C to A, chromosome 8 at 25,022,658 bp
  • T to C, chromosome 8 at 119,876,772 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • G to A, chromosome 8 at 125,491,491 bp
  • T to A, chromosome 9 at 63,616,675 bp
  • T to A, chromosome 9 at 80,123,820 bp
  • A to G, chromosome 9 at 87,715,653 bp
  • A to G, chromosome 9 at 99,296,385 bp
  • C to T, chromosome 9 at 107,658,762 bp
  • A to G, chromosome 9 at 108,565,347 bp
  • G to A, chromosome 9 at 119,964,295 bp
  • C to A, chromosome 10 at 14,770,442 bp
  • G to T, chromosome 10 at 34,127,695 bp
  • T to C, chromosome 10 at 39,848,049 bp
  • G to T, chromosome 10 at 62,990,994 bp
  • A to T, chromosome 10 at 120,106,021 bp
  • A to G, chromosome 10 at 127,336,727 bp
  • A to G, chromosome 10 at 127,563,804 bp
  • A to G, chromosome 10 at 128,123,612 bp
  • A to G, chromosome 10 at 129,133,006 bp
  • A to T, chromosome 11 at 20,698,318 bp
  • G to T, chromosome 11 at 58,423,926 bp
  • C to A, chromosome 11 at 60,189,467 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 80,814,332 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 102,287,553 bp
  • T to C, chromosome 13 at 69,738,664 bp
  • T to A, chromosome 13 at 77,049,219 bp
  • T to C, chromosome 14 at 34,091,916 bp
  • A to G, chromosome 15 at 25,714,108 bp
  • T to C, chromosome 15 at 31,609,572 bp
  • T to C, chromosome 15 at 65,995,851 bp
  • A to T, chromosome 15 at 76,632,661 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • A to G, chromosome 17 at 17,087,884 bp
  • T to A, chromosome 17 at 24,334,266 bp
  • T to A, chromosome 17 at 74,447,951 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • T to C, chromosome 18 at 84,094,543 bp
  • T to G, chromosome 19 at 29,022,847 bp
  • G to A, chromosome 19 at 34,878,980 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
  • G to T, chromosome X at 151,862,641 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2141 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040144-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.