Strain Name:
C57BL/6J-MtgxR2141Btlr/Mmmh
Stock Number:
040144-MU
Citation ID:
RRID:MMRRC_040144-MU
Other Names:
R2141 (G1), C57BL/6J-MtgxR2141Btlr
Major Collection:

Gene Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Sept4
Name: septin 4
Synonyms: Bh5, cell division control-related protein 2b, ARTS, Pnutl2, septin H5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp5, Zfp-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Efnb1
Name: ephrin B1
Synonyms: Lerk2, Elk-L, LERK-2, Stra1, Cek5 ligand, Cek5-L, Eplg2, Epl2, EFL-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Cep70
Name: centrosomal protein 70
Synonyms: C030018L16Rik, 6720484E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 68121
Homologene: 11387
Gon4l
Name: gon-4-like (C.elegans)
Synonyms: 2610100B20Rik, 1500041I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 76022
Homologene: 13002
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: A330051M14Rik, Marta2, FBP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Centg2, Ggap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 347722
Homologene: 56689
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Plcb4
Name: phospholipase C, beta 4
Synonyms: A930039J07Rik, C230058B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: 2810017C20Rik, E130319N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 215351
Homologene: 9196
Eprs
Name: glutamyl-prolyl-tRNA synthetase
Synonyms: 2410081F06Rik, 3010002K18Rik, Qprs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 117599
Homologene: 50463
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Walp3, Tip5, C030005G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: C130040D16Rik, MICAL-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 194401
Homologene: 85288
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, AATYK2, KPI-2, cprk, KPI2, A330101P12Rik, BREK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231876
Homologene: 8948
Pcmtd1
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Synonyms: A030012M09Rik, 8430411F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319263
Homologene: 14180
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: D630048A14Rik, Ki67, Ki-67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Kif18a
Name: kinesin family member 18A
Synonyms: gcd2, B130001M12Rik, N-8 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228421
Homologene: 41820
Lck
Name: lymphocyte protein tyrosine kinase
Synonyms: Hck-3, p56lck
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 16818
HGNC: HGNC:6524
Homologene: 3911
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: C430014N20Rik, Mule, Ureb1, Arf-bp1, Ib772, LOC382250, 5430439H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 59026
Homologene: 45994
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Nat10
Name: N-acetyltransferase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 98956
Homologene: 6785
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: 2700017A04Rik, Ankrd32, Brctd1, C730024G01Rik, Brctx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105377
Homologene: 13000
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226432
Homologene: 5874
Aldoa
Name: aldolase A, fructose-bisphosphate
Synonyms: Aldo1, Aldo-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 11674
HGNC: HGNC:414
Homologene: 123896
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: Daf1, Cromer blood group, complement-glycosylphosphatidylinositol, GPI-DAF, Daf-GPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Aftph
Name: aftiphilin
Synonyms: 9130023F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216549
Homologene: 9764
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 83431
Homologene: 32567
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: p600, A930005E13Rik, 1810009A16Rik, LOC381562, D930005K06Rik, Zubr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 69116
Homologene: 10804
Gprasp1
Name: G protein-coupled receptor associated sorting protein 1
Synonyms: 2210415K24Rik, GASP1, 3110031O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 67298
Homologene: 8809
Zfp960
Name: zinc finger protein 960
Synonyms: BC018101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 449000
Homologene: 133884
Abca17
Name: ATP-binding cassette, sub-family A (ABC1), member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 381072
Homologene: 86807
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 381410
Homologene: 11687
Nmbr
Name: neuromedin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 18101
HGNC: HGNC:7843
Homologene: 20560
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20980
Homologene: 22516
Diablo
Name: diablo, IAP-binding mitochondrial protein
Synonyms: 1700006L01Rik, Smac, 0610041G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 66593
Homologene: 10532
Aagab
Name: alpha- and gamma-adaptin binding protein
Synonyms: 2310007F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66939
VEGA: 9
Homologene: 11648
Ints7
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 77065
Homologene: 9136
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 77805
Homologene: 62166
Zfp473
Name: zinc finger protein 473
Synonyms: D030014N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 243963
Homologene: 18698
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 276919
Homologene: 69193
Tmem98
Name: transmembrane protein 98
Synonyms: 6530411B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 103743
Homologene: 9185
Tmub2
Name: transmembrane and ubiquitin-like domain containing 2
Synonyms: 2010008E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 72053
Homologene: 18581
Rai1
Name: retinoic acid induced 1
Synonyms: Gt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 19377
HGNC: HGNC:9834
Homologene: 7508
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67196
Homologene: 40929
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 268973
VEGA: 17
Homologene: 10924
Calhm6
Name: calcium homeostasis modulator family member 6
Synonyms: A630077B13Rik, Fam26f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215900
VEGA: 10
Homologene: 25235
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: A2mr, b2b1554Clo, CD91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
4932431P20Rik
Name: RIKEN cDNA 4932431P20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 114675
Nkpd1
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 69547
Homologene: 18876
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 207618
Homologene: 52304
Abca15
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 320631
Homologene: 87255
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74052
Homologene: 14728
1810065E05Rik
Name: RIKEN cDNA 1810065E05 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69864
Homologene: 87042
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, tie-1, D430008P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 21846
Homologene: 3957
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Rev, Sez4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Rufy2
Name: RUN and FYVE domain-containing 2
Synonyms: 2610111M19Rik, LZ-FYVE, Denn, ZFYVE13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70432
Homologene: 23064
Rtraf-ps
Name: RNA transcription, translation and transport factor, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545536
Anxa8
Name: annexin A8
Synonyms: Anx8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 11752
Homologene: 20393
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70729
Homologene: 135990
Olfr1025-ps1
Name: olfactory receptor 1025, pseudogene 1
Synonyms: MOR196-6_p, GA_x6K02T2Q125-47397266-47398205, MOR196-5P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258083
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381293
Homologene: 8916
Kctd16
Name: potassium channel tetramerisation domain containing 16
Synonyms: 4930434H12Rik, 2900055J20Rik, LOC383347
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 73001
VEGA: 18
Homologene: 44779
Flnc
Name: filamin C, gamma
Synonyms: actin binding protein 280, Fln2, 1110055E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227058
Homologene: 41287
Tbx18
Name: T-box18
Synonyms: 2810404D13Rik, 2810012F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 76365
Homologene: 11384
Gjc3
Name: gap junction protein, gamma 3
Synonyms: Gje1, connexin 29, Cx29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 118446
Homologene: 15399
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226438
Homologene: 130054
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244668
Homologene: 18956
Ube2ql1
Name: ubiquitin-conjugating enzyme E2Q family-like 1
Synonyms: 3110006E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 76980
VEGA: 13
Homologene: 15975
Kif21b
Name: kinesin family member 21B
Synonyms: 2610511N21Rik, N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16565
Homologene: 56868
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319901
Homologene: 12964
Nfasc
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269116
Homologene: 24945
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17858
Ren1
Name: renin 1 structural
Synonyms: Ren-A, Ren-1, Ren, Ren1c, Rnr, Ren1d, Rn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Myo18b
Name: myosin XVIIIb
Synonyms: 4933411E19Rik, 4932408L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 74376
Homologene: 53435
Ak3
Name: adenylate kinase 3
Synonyms: AK-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 56248
Homologene: 21744
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 636808
Homologene: 43974
Phkg2
Name: phosphorylase kinase, gamma 2 (testis)
Synonyms: 1500017I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 68961
HGNC: HGNC:8931
Homologene: 47915
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Pank1
Name: pantothenate kinase 1
Synonyms: Pank1b, 4632412I06Rik, Pank1, Pank1a, 5430426F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 75735
VEGA: 19
HGNC: HGNC:8598
Homologene: 56979
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, A530054J02Rik, Ssa, Trove2, 1810007I17Rik, Ssa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20822
Homologene: 3383
AC135640.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
Atpsckmt
Name: ATP synthase C subunit lysine N-methyltransferase
Synonyms: A930016P21Rik, Fam173b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 68073
Homologene: 16780
Tm2d2
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 69742
Homologene: 12328
Klhl36
Name: kelch-like 36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234796
Homologene: 32598
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: mt2r49, T2R15, Tas2r15, mGR15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 353325
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545366
Homologene: 134349
Olfr1173
Name: olfactory receptor 1173
Synonyms: MOR174-20_p, GA_x6K02T2Q125-49759783-49758845
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 404329
Homologene: 128091
AC164610.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
Uap1l1
Name: UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227620
Homologene: 71313
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: Snat3, 0610012J02Rik, D9Ucla2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 76257
Homologene: 4983
Pramel7
Name: preferentially expressed antigen in melanoma like 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 347712
Homologene: 87261
Zadh2
Name: zinc binding alcohol dehydrogenase, domain containing 2
Synonyms: Pthr3, C530046K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225791
VEGA: 18
Homologene: 38387
N4bp2l2
Name: NEDD4 binding protein 2-like 2
Synonyms: zag1, 2700092H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381695
Homologene: 115380
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cardiac TnT, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21956
Homologene: 68050
Olfr770
Name: olfactory receptor 770
Synonyms: MOR114-5, GA_x6K02T2PULF-10819232-10818297
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258862
Homologene: 27285
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 194231
Homologene: 4604
Gm4907
Name: predicted gene 4907
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 236749
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Olfr1289
Name: olfactory receptor 1289
Synonyms: GA_x6K02T2Q125-72534883-72535821, MOR245-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258399
HGNC: HGNC:8301
Nipa1
Name: non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Synonyms: 1110027G09Rik, A830014A18Rik, Spg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233280
Homologene: 42327
Slc43a1
Name: solute carrier family 43, member 1
Synonyms: 2610016F07Rik, Pov1, Lat3, PB39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 72401
HGNC: HGNC:9225
Homologene: 2688
Kiss1
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 280287
HGNC: HGNC:6341
Homologene: 1701
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 55978
Homologene: 49559
Gm6252
Name: predicted gene 6252
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 621699
VEGA: 19
Pla2g1b
Name: phospholipase A2, group IB, pancreas
Synonyms: sPLA2IB, Pla2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18778
HGNC: HGNC:9030
Homologene: 715
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 7,169,565 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 89,837,755 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • CAT to CATTAT, chromosome 1 at 115,900,919 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • G to A, chromosome 1 at 132,596,645 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • C to T, chromosome 1 at 136,152,264 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 1 at 170,329,166 bp
  • T to C, chromosome 1 at 185,410,249 bp
  • T to A, chromosome 1 at 191,604,860 bp
  • A to G, chromosome 2 at 25,362,857 bp
  • A to G, chromosome 2 at 31,600,557 bp
  • T to C, chromosome 2 at 84,840,961 bp
  • A to G, chromosome 2 at 85,918,827 bp
  • T to A, chromosome 2 at 87,489,977 bp
  • A to G, chromosome 2 at 88,275,010 bp
  • A to G, chromosome 2 at 91,647,849 bp
  • T to C, chromosome 2 at 103,731,303 bp
  • T to A, chromosome 2 at 109,333,503 bp
  • A to T, chromosome 2 at 111,483,630 bp
  • G to A, chromosome 2 at 135,976,099 bp
  • T to A, chromosome 3 at 88,576,642 bp
  • A to T, chromosome 3 at 88,887,595 bp
  • G to A, chromosome 4 at 118,472,811 bp
  • A to G, chromosome 4 at 129,548,920 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • A to G, chromosome 5 at 6,772,583 bp
  • T to C, chromosome 5 at 112,874,026 bp
  • T to C, chromosome 5 at 115,470,950 bp
  • A to G, chromosome 5 at 123,523,361 bp
  • A to C, chromosome 5 at 137,957,546 bp
  • A to G, chromosome 5 at 144,147,615 bp
  • A to T, chromosome 5 at 150,647,536 bp
  • A to G, chromosome 6 at 29,448,675 bp
  • A to G, chromosome 6 at 113,549,321 bp
  • A to T, chromosome 6 at 121,031,134 bp
  • T to C, chromosome 6 at 132,737,358 bp
  • A to G, chromosome 6 at 133,529,275 bp
  • A to G, chromosome 7 at 19,524,237 bp
  • T to C, chromosome 7 at 29,531,510 bp
  • T to C, chromosome 7 at 44,733,077 bp
  • C to A, chromosome 7 at 55,997,511 bp
  • T to A, chromosome 7 at 106,329,956 bp
  • A to C, chromosome 7 at 120,407,474 bp
  • G to T, chromosome 7 at 125,219,453 bp
  • A to G, chromosome 7 at 126,797,642 bp
  • G to A, chromosome 7 at 127,582,214 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • C to A, chromosome 8 at 25,022,658 bp
  • T to C, chromosome 8 at 119,876,772 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • G to A, chromosome 8 at 125,491,491 bp
  • T to A, chromosome 9 at 63,616,675 bp
  • T to A, chromosome 9 at 80,123,820 bp
  • A to G, chromosome 9 at 87,715,653 bp
  • A to G, chromosome 9 at 99,296,385 bp
  • C to T, chromosome 9 at 107,658,762 bp
  • A to G, chromosome 9 at 108,565,347 bp
  • G to A, chromosome 9 at 119,964,295 bp
  • C to A, chromosome 10 at 14,770,442 bp
  • G to T, chromosome 10 at 34,127,695 bp
  • T to C, chromosome 10 at 39,848,049 bp
  • G to T, chromosome 10 at 62,990,994 bp
  • A to T, chromosome 10 at 120,106,021 bp
  • A to G, chromosome 10 at 127,336,727 bp
  • A to G, chromosome 10 at 127,563,804 bp
  • A to G, chromosome 10 at 128,123,612 bp
  • A to G, chromosome 10 at 129,133,006 bp
  • A to T, chromosome 11 at 20,698,318 bp
  • G to T, chromosome 11 at 58,423,926 bp
  • C to A, chromosome 11 at 60,189,467 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 80,814,332 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • A to G, chromosome 11 at 102,287,553 bp
  • T to C, chromosome 13 at 69,738,664 bp
  • T to A, chromosome 13 at 77,049,219 bp
  • T to C, chromosome 14 at 34,091,916 bp
  • A to G, chromosome 15 at 25,714,108 bp
  • T to C, chromosome 15 at 31,609,572 bp
  • T to C, chromosome 15 at 65,995,851 bp
  • A to T, chromosome 15 at 76,632,661 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • A to G, chromosome 17 at 17,087,884 bp
  • T to A, chromosome 17 at 24,334,266 bp
  • T to A, chromosome 17 at 74,447,951 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • T to C, chromosome 18 at 84,094,543 bp
  • T to G, chromosome 19 at 29,022,847 bp
  • G to A, chromosome 19 at 34,878,980 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
  • G to T, chromosome X at 151,862,641 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2141 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040144-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.