MMRRC:040146-MU

A to G, chromosome 1 at 16,078,703 bp
C to T, chromosome 1 at 17,749,636 bp
G to T, chromosome 1 at 37,387,746 bp
T to A, chromosome 1 at 44,210,238 bp
C to A, chromosome 1 at 75,363,464 bp
T to A, chromosome 1 at 93,271,684 bp
C to T, chromosome 1 at 93,321,297 bp
C to T, chromosome 1 at 94,009,451 bp
T to C, chromosome 1 at 96,922,067 bp
T to C, chromosome 1 at 130,698,723 bp
C to A, chromosome 1 at 131,273,474 bp
T to A, chromosome 1 at 132,463,375 bp
T to C, chromosome 1 at 166,269,326 bp
A to T, chromosome 2 at 70,426,046 bp
A to T, chromosome 2 at 82,990,271 bp
C to T, chromosome 2 at 89,363,103 bp
A to G, chromosome 2 at 91,565,745 bp
C to A, chromosome 2 at 120,030,120 bp
A to T, chromosome 2 at 121,216,064 bp
T to A, chromosome 2 at 121,301,945 bp
A to T, chromosome 2 at 126,374,510 bp
T to C, chromosome 2 at 127,433,762 bp
T to C, chromosome 2 at 130,957,996 bp
T to A, chromosome 2 at 147,365,882 bp
C to A, chromosome 2 at 164,289,884 bp
G to A, chromosome 3 at 41,604,708 bp
C to T, chromosome 3 at 87,745,521 bp
T to A, chromosome 3 at 88,985,419 bp
T to A, chromosome 3 at 93,670,836 bp
T to A, chromosome 3 at 97,888,519 bp
A to C, chromosome 3 at 142,503,832 bp
T to C, chromosome 3 at 154,258,449 bp
T to C, chromosome 4 at 40,744,073 bp
T to C, chromosome 4 at 43,648,166 bp
T to C, chromosome 4 at 58,812,632 bp
T to A, chromosome 4 at 65,180,949 bp
G to A, chromosome 4 at 88,868,174 bp
T to A, chromosome 4 at 88,868,175 bp
T to C, chromosome 4 at 134,093,737 bp
C to A, chromosome 4 at 134,371,044 bp
T to C, chromosome 4 at 134,580,767 bp
A to T, chromosome 5 at 24,100,863 bp
A to G, chromosome 5 at 33,160,796 bp
A to AG, chromosome 5 at 33,769,515 bp
T to A, chromosome 5 at 88,492,920 bp
A to G, chromosome 5 at 103,556,133 bp
C to G, chromosome 5 at 109,736,750 bp
T to A, chromosome 5 at 115,552,756 bp
A to T, chromosome 5 at 149,631,486 bp
C to T, chromosome 6 at 4,515,200 bp
C to T, chromosome 6 at 39,168,950 bp
T to C, chromosome 6 at 83,102,222 bp
T to G, chromosome 6 at 85,868,257 bp
T to A, chromosome 6 at 113,672,827 bp
T to A, chromosome 6 at 124,724,984 bp
A to T, chromosome 7 at 3,844,345 bp
A to G, chromosome 7 at 30,105,340 bp
G to T, chromosome 7 at 31,291,763 bp
A to G, chromosome 7 at 45,887,040 bp
G to A, chromosome 7 at 57,489,015 bp
G to A, chromosome 7 at 65,655,791 bp
A to G, chromosome 7 at 65,695,239 bp
C to A, chromosome 7 at 86,811,944 bp
A to T, chromosome 7 at 109,475,113 bp
A to G, chromosome 7 at 112,560,067 bp
G to A, chromosome 7 at 126,448,725 bp
G to A, chromosome 7 at 126,587,116 bp
T to G, chromosome 8 at 3,622,355 bp
T to A, chromosome 8 at 43,193,511 bp
T to A, chromosome 8 at 61,028,696 bp
T to C, chromosome 8 at 67,964,351 bp
T to C, chromosome 8 at 70,339,354 bp
T to A, chromosome 8 at 70,910,964 bp
T to C, chromosome 8 at 71,398,440 bp
A to G, chromosome 8 at 88,347,064 bp
C to T, chromosome 8 at 94,296,480 bp
T to C, chromosome 8 at 105,308,673 bp
A to G, chromosome 8 at 109,724,347 bp
T to A, chromosome 8 at 122,479,152 bp
G to T, chromosome 9 at 9,748,415 bp
G to A, chromosome 9 at 18,988,803 bp
T to A, chromosome 9 at 20,937,155 bp
T to A, chromosome 9 at 49,543,019 bp
T to A, chromosome 9 at 58,138,968 bp
T to A, chromosome 9 at 67,338,200 bp
A to G, chromosome 9 at 72,312,729 bp
C to A, chromosome 9 at 99,505,308 bp
T to A, chromosome 9 at 107,956,435 bp
T to C, chromosome 9 at 114,379,968 bp
T to C, chromosome 9 at 114,437,824 bp
T to G, chromosome 9 at 122,853,482 bp
T to C, chromosome 10 at 93,218,019 bp
G to T, chromosome 11 at 21,328,949 bp
T to A, chromosome 11 at 35,612,261 bp
T to C, chromosome 11 at 62,592,786 bp
A to T, chromosome 11 at 98,896,214 bp
T to C, chromosome 11 at 99,580,818 bp
A to T, chromosome 11 at 99,792,963 bp
A to T, chromosome 11 at 107,181,055 bp
GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
A to G, chromosome 12 at 50,489,911 bp
A to G, chromosome 12 at 69,741,054 bp
T to C, chromosome 12 at 84,650,162 bp
A to C, chromosome 12 at 98,810,605 bp
A to G, chromosome 13 at 36,877,737 bp
T to C, chromosome 13 at 55,260,397 bp
A to G, chromosome 13 at 63,210,177 bp
C to T, chromosome 13 at 100,299,859 bp
A to G, chromosome 13 at 102,735,475 bp
A to T, chromosome 13 at 104,124,259 bp
A to G, chromosome 14 at 41,174,570 bp
A to T, chromosome 14 at 54,952,954 bp
C to A, chromosome 14 at 70,394,213 bp
A to T, chromosome 15 at 43,513,739 bp
T to C, chromosome 15 at 66,532,586 bp
T to C, chromosome 15 at 76,613,592 bp
T to C, chromosome 15 at 85,123,802 bp
A to G, chromosome 15 at 101,712,359 bp
A to G, chromosome 16 at 10,240,645 bp
A to G, chromosome 16 at 56,169,806 bp
G to C, chromosome 16 at 88,759,165 bp
A to G, chromosome 18 at 19,980,686 bp
T to A, chromosome 18 at 20,579,161 bp
T to A, chromosome 18 at 31,796,079 bp
A to G, chromosome 18 at 34,625,604 bp
A to G, chromosome 18 at 36,762,366 bp
A to G, chromosome 18 at 58,052,993 bp
A to T, chromosome 19 at 3,649,396 bp
A to T, chromosome 19 at 5,279,838 bp
A to T, chromosome 19 at 29,533,252 bp
G to A, chromosome 19 at 29,533,253 bp
A to T, chromosome 19 at 38,162,329 bp
T to C, chromosome 19 at 40,736,783 bp
T to C, chromosome 19 at 55,298,796 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R2143 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
040146-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All