Strain Name:
C57BL/6J-MtgxR2143Btlr/Mmmh
Stock Number:
040146-MU
Citation ID:
RRID:MMRRC_040146-MU
Other Names:
R2143 (G1), C57BL/6J-MtgxR2143Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Tln2
Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Cdk17
Name: cyclin dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Krt5
Name: keratin 5
Synonyms: 3300001P10Rik, Tfip8, K5, Krt2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110308
HGNC: HGNC:6442
Homologene: 55461
Upf1
Name: UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Pxn
Name: paxillin
Synonyms: Pax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19303
HGNC: HGNC:9718
Homologene: 37697
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20564
Homologene: 2303
Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 269424
Homologene: 18162
Dnmt1
Name: DNA methyltransferase (cytosine-5) 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22036
Homologene: 31343
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27223
Homologene: 4137
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LR3, LRP7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75786
Homologene: 8844
Brd7
Name: bromodomain containing 7
Synonyms: bromodomain protein 75 kDa, BP75, CELTIX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 26992
Homologene: 8085
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328329
Homologene: 42094
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71805
Homologene: 40971
Polr2d
Name: polymerase (RNA) II (DNA directed) polypeptide D
Synonyms: 2310002G05Rik, HSRBP4, RBP4, 2610028L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 69241
VEGA: 18
HGNC: HGNC:9191
Homologene: 37968
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66315
Homologene: 10778
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Armc8
Name: armadillo repeat containing 8
Synonyms: HSPC056, 1200015K23Rik, Gid5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74125
Homologene: 9121
Klhl7
Name: kelch-like 7
Synonyms: 2700038B03Rik, SBBI26, Klhl6, D5Ertd363e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52323
Homologene: 10317
Emc2
Name: ER membrane protein complex subunit 2
Synonyms: 4921531G14Rik, Ttc35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66736
VEGA: 15
Homologene: 8785
Ptpn6
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: SHP-1, Ptp1C, hcp, Hcph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15170
HGNC: HGNC:9658
Homologene: 56589
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330627
Homologene: 28044
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226089
Homologene: 13806
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp-E7I, HSP110, Hsp105, hsp110/105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15505
Homologene: 21322
Wipf2
Name: WAS/WASL interacting protein family, member 2
Synonyms: 1110014J05Rik, 5730509C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68524
Homologene: 15777
Letm1
Name: leucine zipper-EF-hand containing transmembrane protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56384
HGNC: HGNC:6556
Homologene: 56320
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230249
Homologene: 6056
Slc39a4
Name: solute carrier family 39 (zinc transporter), member 4
Synonyms: zip4, 1600025H15Rik, AWMS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72027
VEGA: 15
Homologene: 15638
Zdhhc6
Name: zinc finger, DHHC domain containing 6
Synonyms: 5930409M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66980
VEGA: 19
Homologene: 41487
Smu1
Name: smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms: 2600001O03Rik, SMU-1, 2610203K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74255
Homologene: 10079
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Triml2
Name: tripartite motif family-like 2
Synonyms: EG622117
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 622117
Homologene: 18316
4930522L14Rik
Name: RIKEN cDNA 4930522L14 gene
Synonyms: Gm42152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100041734
Crispld1
Name: cysteine-rich secretory protein LCCL domain containing 1
Synonyms: Cocoacrisp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 83691
Homologene: 12857
Glb1
Name: galactosidase, beta 1
Synonyms: Bgs, Bge, Bgt, Bgl, Bgl-t, Bgl-s, Bgl-e, C130097A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Nol11
Name: nucleolar protein 11
Synonyms: 1500002M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68979
Homologene: 32264
Atf7ip2
Name: activating transcription factor 7 interacting protein 2
Synonyms: 4930558K11Rik, PSM2, Get-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 75329
Homologene: 23509
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Pask
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269224
Homologene: 9038
Sf3b2
Name: splicing factor 3b, subunit 2
Synonyms: 2810441F20Rik, 145kDa, SF3b150, SF3b145, SAP145, SF3b1, B230398H18Rik, 2610311M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 319322
VEGA: 19
Homologene: 6678
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Map1s
Name: microtubule-associated protein 1S
Synonyms: VCY2IP1, 6430517J16Rik, Bpy2ip1, Map8, Mtap1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270058
Homologene: 10047
Tarsl2
Name: threonyl-tRNA synthetase-like 2
Synonyms: A530046H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272396
Homologene: 65036
Stra6
Name: stimulated by retinoic acid gene 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20897
Homologene: 7554
Pax1
Name: paired box 1
Synonyms: Pax-1, wt, hbs, hunchback, wavy tail
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18503
HGNC: HGNC:8615
Homologene: 4514
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Irak2
Name: interleukin-1 receptor-associated kinase 2
Synonyms: 6330415L08Rik, IRAK-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108960
HGNC: HGNC:6113
Homologene: 1207
Sgtb
Name: small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Synonyms: C630001O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218544
Homologene: 10409
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Ctu2
Name: cytosolic thiouridylase subunit 2
Synonyms: 2310061F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66965
Homologene: 79815
Gabra5
Name: gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110886
HGNC: HGNC:4079
Homologene: 20219
Trpv2
Name: transient receptor potential cation channel, subfamily V, member 2
Synonyms: Vrl1, OTRPC2, VRL-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22368
Homologene: 7993
Gbp5
Name: guanylate binding protein 5
Synonyms: 5330409J06Rik, Gbp5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229898
Homologene: 14183
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242259
Homologene: 72094
Des
Name: desmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Kdm7a
Name: lysine (K)-specific demethylase 7A
Synonyms: A630082K20Rik, ENSMUSG00000073143, Kdm7a, Jhdm1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 338523
Homologene: 25281
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546983
Homologene: 115466
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234353
Homologene: 87257
Tdpoz1
Name: TD and POZ domain containing 1
Synonyms: 2cpoz56, Spopl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 207213
Homologene: 128308
Nat8f2
Name: N-acetyltransferase 8 (GCN5-related) family member 2
Synonyms: Cml2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93673
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 83679
Homologene: 66961
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, PAPP-A, IGFBP-4ase, 8430414N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215456
Homologene: 19037
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329421
Homologene: 51393
Pfkfb2
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18640
HGNC: HGNC:8873
Homologene: 88554
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Gal3st2c
Name: galactose-3-O-sulfotransferase 2C
Synonyms: Gm6086
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 619597
Homologene: 41471
Tm2d3
Name: TM2 domain containing 3
Synonyms: 5930422O05Rik, 1110025I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68634
Homologene: 12275
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Elmo3
Name: engulfment and cell motility 3
Synonyms: CED-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234683
Homologene: 23475
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Slco6b1
Name: solute carrier organic anion transporter family, member 6b1
Synonyms: 1700022M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67854
Homologene: 12199
Pla2g4b
Name: phospholipase A2, group IVB (cytosolic)
Synonyms: A030011C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211429
Homologene: 3730
4832428D23Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Slc5a1
Name: solute carrier family 5 (sodium/glucose cotransporter), member 1
Synonyms: Sglt1, sodium glucose cotransporter 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20537
Homologene: 55456
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Man1c1
Name: mannosidase, alpha, class 1C, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230815
Homologene: 69303
Scgb1b2
Name: secretoglobin, family 1B, member 2
Synonyms: lacrimal gland protein, LGP, Scgb1b1, Mja1l, Apbh, Abph, Abpa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57426
Homologene: 114479
Cntn5
Name: contactin 5
Synonyms: LOC244683, NB-2, A830025P08Rik, 6720426O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244682
HGNC: HGNC:2175
Homologene: 28447
Gm11596
Name: predicted gene 11596
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 670464
Homologene: 124486
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, Snep, D430044C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Piwil2
Name: piwi-like RNA-mediated gene silencing 2
Synonyms: Miwi like, mili
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 57746
VEGA: 14
Homologene: 23071
Babam1
Name: BRISC and BRCA1 A complex member 1
Synonyms: 5430437P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 68251
Homologene: 8574
Zfp821
Name: zinc finger protein 821
Synonyms: 4930566A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 75871
Homologene: 32345
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241633
Homologene: 133162
Parva
Name: parvin, alpha
Synonyms: CH-ILKBP, 5430400F08Rik, 2010012A22Rik, actopaxin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57342
Homologene: 10077
Dmac2l
Name: distal membrane arm assembly component 2 like
Synonyms: facyor B, 1110015E18Rik, Atp5s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68055
VEGA: 12
Homologene: 12232
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Lrrc71
Name: leucine rich repeat containing 71
Synonyms: 4933430H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74485
Homologene: 83646
Ikbke
Name: inhibitor of kappaB kinase epsilon
Synonyms: IKK-i, IKKepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56489
Homologene: 23168
Entpd1
Name: ectonucleoside triphosphate diphosphohydrolase 1
Synonyms: NTPDase-1, Cd39, ectoapyrase, 2610206B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12495
HGNC: HGNC:3363
Homologene: 20423
Ccdc142
Name: coiled-coil domain containing 142
Synonyms: A230058J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243510
Homologene: 27813
Or7g12
Name: olfactory receptor family 7 subfamily G member 12
Synonyms: GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p, MOR153-2, Olfr834
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258074
HGNC: HGNC:8467
Homologene: 128143
Svs3a
Name: seminal vesicle secretory protein 3A
Synonyms: Svp-3, 9530026M05Rik, Svp3, SVS III, Svs3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64335
Homologene: 110771
Pira2
Name: paired-Ig-like receptor A2
Synonyms: 6M23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18725
Homologene: 134028
Apobr
Name: apolipoprotein B receptor
Synonyms: Apob-48r, Apob48r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171504
Homologene: 26695
Or4a15
Name: olfactory receptor family 4 subfamily A member 15
Synonyms: GA_x6K02T2Q125-50805620-50804676, MOR231-2, Olfr1234
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258975
Homologene: 128156
Pet100
Name: PET100 homolog
Synonyms: 2900053A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100503890
Homologene: 87502
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
Wdr55
Name: WD repeat domain 55
Synonyms: 2410080P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67936
VEGA: 18
Homologene: 9789
Sftpd
Name: surfactant associated protein D
Synonyms: SP-D, Sftp4, Sfpd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 20390
VEGA: 14
Homologene: 2272
Ugp2
Name: UDP-glucose pyrophosphorylase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216558
Homologene: 121676
Zfp260
Name: zinc finger protein 260
Synonyms: Ozrf1, PEX1, Zfp63
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26466
Homologene: 40802
Syngr4
Name: synaptogyrin 4
Synonyms: 1700016O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 58867
Homologene: 8258
4930444P10Rik
Name: RIKEN cDNA 4930444P10 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75799
Homologene: 90802
Cd52
Name: CD52 antigen
Synonyms: MB7, CLS1, B7, CAMPATH-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 23833
HGNC: HGNC:1804
Crtap
Name: cartilage associated protein
Synonyms: CASP, 5730529N23Rik, Leprel3, P3h5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56693
HGNC: HGNC:2379
Homologene: 21280
Krtap1-5
Name: keratin associated protein 1-5
Synonyms: 2310043L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69664
Homologene: 75252
2310034C09Rik
Name: RIKEN cDNA 2310034C09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 117172
Homologene: 114409
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 16,078,703 bp
  • C to T, chromosome 1 at 17,749,636 bp
  • G to T, chromosome 1 at 37,387,746 bp
  • T to A, chromosome 1 at 44,210,238 bp
  • C to A, chromosome 1 at 75,363,464 bp
  • T to A, chromosome 1 at 93,271,684 bp
  • C to T, chromosome 1 at 93,321,297 bp
  • C to T, chromosome 1 at 94,009,451 bp
  • T to C, chromosome 1 at 96,922,067 bp
  • T to C, chromosome 1 at 130,698,723 bp
  • C to A, chromosome 1 at 131,273,474 bp
  • T to A, chromosome 1 at 132,463,375 bp
  • T to C, chromosome 1 at 166,269,326 bp
  • A to T, chromosome 2 at 70,426,046 bp
  • A to T, chromosome 2 at 82,990,271 bp
  • C to T, chromosome 2 at 89,363,103 bp
  • A to G, chromosome 2 at 91,565,745 bp
  • C to A, chromosome 2 at 120,030,120 bp
  • A to T, chromosome 2 at 121,216,064 bp
  • T to A, chromosome 2 at 121,301,945 bp
  • A to T, chromosome 2 at 126,374,510 bp
  • T to C, chromosome 2 at 127,433,762 bp
  • T to C, chromosome 2 at 130,957,996 bp
  • T to A, chromosome 2 at 147,365,882 bp
  • C to A, chromosome 2 at 164,289,884 bp
  • G to A, chromosome 3 at 41,604,708 bp
  • C to T, chromosome 3 at 87,745,521 bp
  • T to A, chromosome 3 at 88,985,419 bp
  • T to A, chromosome 3 at 93,670,836 bp
  • T to A, chromosome 3 at 97,888,519 bp
  • A to C, chromosome 3 at 142,503,832 bp
  • T to C, chromosome 3 at 154,258,449 bp
  • T to C, chromosome 4 at 40,744,073 bp
  • T to C, chromosome 4 at 43,648,166 bp
  • T to C, chromosome 4 at 58,812,632 bp
  • T to A, chromosome 4 at 65,180,949 bp
  • G to A, chromosome 4 at 88,868,174 bp
  • T to A, chromosome 4 at 88,868,175 bp
  • T to C, chromosome 4 at 134,093,737 bp
  • C to A, chromosome 4 at 134,371,044 bp
  • T to C, chromosome 4 at 134,580,767 bp
  • A to T, chromosome 5 at 24,100,863 bp
  • A to G, chromosome 5 at 33,160,796 bp
  • A to AG, chromosome 5 at 33,769,515 bp
  • T to A, chromosome 5 at 88,492,920 bp
  • A to G, chromosome 5 at 103,556,133 bp
  • C to G, chromosome 5 at 109,736,750 bp
  • T to A, chromosome 5 at 115,552,756 bp
  • A to T, chromosome 5 at 149,631,486 bp
  • C to T, chromosome 6 at 4,515,200 bp
  • C to T, chromosome 6 at 39,168,950 bp
  • T to C, chromosome 6 at 83,102,222 bp
  • T to G, chromosome 6 at 85,868,257 bp
  • T to A, chromosome 6 at 113,672,827 bp
  • T to A, chromosome 6 at 124,724,984 bp
  • A to T, chromosome 7 at 3,844,345 bp
  • A to G, chromosome 7 at 30,105,340 bp
  • G to T, chromosome 7 at 31,291,763 bp
  • A to G, chromosome 7 at 45,887,040 bp
  • G to A, chromosome 7 at 57,489,015 bp
  • G to A, chromosome 7 at 65,655,791 bp
  • A to G, chromosome 7 at 65,695,239 bp
  • C to A, chromosome 7 at 86,811,944 bp
  • A to T, chromosome 7 at 109,475,113 bp
  • A to G, chromosome 7 at 112,560,067 bp
  • G to A, chromosome 7 at 126,448,725 bp
  • G to A, chromosome 7 at 126,587,116 bp
  • T to G, chromosome 8 at 3,622,355 bp
  • T to A, chromosome 8 at 43,193,511 bp
  • T to A, chromosome 8 at 61,028,696 bp
  • T to C, chromosome 8 at 67,964,351 bp
  • T to C, chromosome 8 at 70,339,354 bp
  • T to A, chromosome 8 at 70,910,964 bp
  • T to C, chromosome 8 at 71,398,440 bp
  • A to G, chromosome 8 at 88,347,064 bp
  • C to T, chromosome 8 at 94,296,480 bp
  • T to C, chromosome 8 at 105,308,673 bp
  • A to G, chromosome 8 at 109,724,347 bp
  • T to A, chromosome 8 at 122,479,152 bp
  • G to T, chromosome 9 at 9,748,415 bp
  • G to A, chromosome 9 at 18,988,803 bp
  • T to A, chromosome 9 at 20,937,155 bp
  • T to A, chromosome 9 at 49,543,019 bp
  • T to A, chromosome 9 at 58,138,968 bp
  • T to A, chromosome 9 at 67,338,200 bp
  • A to G, chromosome 9 at 72,312,729 bp
  • C to A, chromosome 9 at 99,505,308 bp
  • T to A, chromosome 9 at 107,956,435 bp
  • T to C, chromosome 9 at 114,379,968 bp
  • T to C, chromosome 9 at 114,437,824 bp
  • T to G, chromosome 9 at 122,853,482 bp
  • T to C, chromosome 10 at 93,218,019 bp
  • G to T, chromosome 11 at 21,328,949 bp
  • T to A, chromosome 11 at 35,612,261 bp
  • T to C, chromosome 11 at 62,592,786 bp
  • A to T, chromosome 11 at 98,896,214 bp
  • T to C, chromosome 11 at 99,580,818 bp
  • A to T, chromosome 11 at 99,792,963 bp
  • A to T, chromosome 11 at 107,181,055 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • A to G, chromosome 12 at 50,489,911 bp
  • A to G, chromosome 12 at 69,741,054 bp
  • T to C, chromosome 12 at 84,650,162 bp
  • A to C, chromosome 12 at 98,810,605 bp
  • A to G, chromosome 13 at 36,877,737 bp
  • T to C, chromosome 13 at 55,260,397 bp
  • A to G, chromosome 13 at 63,210,177 bp
  • C to T, chromosome 13 at 100,299,859 bp
  • A to G, chromosome 13 at 102,735,475 bp
  • A to T, chromosome 13 at 104,124,259 bp
  • A to G, chromosome 14 at 41,174,570 bp
  • A to T, chromosome 14 at 54,952,954 bp
  • C to A, chromosome 14 at 70,394,213 bp
  • A to T, chromosome 15 at 43,513,739 bp
  • T to C, chromosome 15 at 66,532,586 bp
  • T to C, chromosome 15 at 76,613,592 bp
  • T to C, chromosome 15 at 85,123,802 bp
  • A to G, chromosome 15 at 101,712,359 bp
  • A to G, chromosome 16 at 10,240,645 bp
  • A to G, chromosome 16 at 56,169,806 bp
  • G to C, chromosome 16 at 88,759,165 bp
  • A to G, chromosome 18 at 19,980,686 bp
  • T to A, chromosome 18 at 20,579,161 bp
  • T to A, chromosome 18 at 31,796,079 bp
  • A to G, chromosome 18 at 34,625,604 bp
  • A to G, chromosome 18 at 36,762,366 bp
  • A to G, chromosome 18 at 58,052,993 bp
  • A to T, chromosome 19 at 3,649,396 bp
  • A to T, chromosome 19 at 5,279,838 bp
  • A to T, chromosome 19 at 29,533,252 bp
  • G to A, chromosome 19 at 29,533,253 bp
  • A to T, chromosome 19 at 38,162,329 bp
  • T to C, chromosome 19 at 40,736,783 bp
  • T to C, chromosome 19 at 55,298,796 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2143 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040146-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.