Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2187Btlr/Mmmh
Stock Number:
040189-MU
Citation ID:
RRID:MMRRC_040189-MU
Other Names:
R2187 (G1), C57BL/6J-MtgxR2187Btlr
Major Collection:

Strain Information

Pip5k1a
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
Synonyms: Pipk5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18720
HGNC: HGNC:8994
Homologene: 93492
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, G630026H09Rik, Srisnf2l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Nol9
Name: nucleolar protein 9
Synonyms: 6030462G04Rik, 4632412I24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74035
Homologene: 32589
Rhoa
Name: ras homolog family member A
Synonyms: RhoA, Arha2, Arha1, Arha
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11848
HGNC: HGNC:667
Homologene: 68986
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: White, Abc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, ERAAP, Arts1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, DP, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Dnmt3l
Name: DNA methyltransferase 3-like
Synonyms: D6Ertd14e, ecat7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54427
HGNC: HGNC:2980
Homologene: 8362
Nipsnap2
Name: nipsnap homolog 2
Synonyms: Nipsnap2, Gbas
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14467
HGNC: HGNC:4179
Homologene: 1137
Cd2bp2
Name: CD2 cytoplasmic tail binding protein 2
Synonyms: 2410024K20Rik, 1500011B02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70233
HGNC: HGNC:1656
Homologene: 4455
Nol8
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, D13Ertd548e, 5730412B09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Ppp2cb
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Synonyms: D8Ertd766e, PP2Ac
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19053
HGNC: HGNC:9300
Homologene: 37889
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Hsf5
Name: heat shock transcription factor family member 5
Synonyms: LOC327992
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327992
Homologene: 52701
Chmp6
Name: charged multivesicular body protein 6
Synonyms: 2400004G01Rik, chromatin modifying protein 6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208092
Homologene: 11607
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Rnpepl1
Name: arginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms: 1110014H17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108657
Homologene: 36367
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69217
Homologene: 10848
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: CDC25Mm, Grfbeta, CDC25, Grf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Mst1
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: DNF15S2h, D9H3F15S2, D3F15S2h, Hgfl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
AI597479
Name: expressed sequence AI597479
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98404
Homologene: 11459
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Or6c33
Name: olfactory receptor family 6 subfamily C member 33
Synonyms: GA_x6K02T2PULF-11688441-11689379, MOR116-1, Olfr820
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258670
Homologene: 17337
Sel1l2
Name: sel-1 suppressor of lin-12-like 2 (C. elegans)
Synonyms: LOC228684
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228684
Homologene: 16802
Mrgpra9
Name: MAS-related GPR, member A9
Synonyms: MrgA9, EG668725
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668725
Homologene: 79615
Bfsp2
Name: beaded filament structural protein 2, phakinin
Synonyms: CP49
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107993
HGNC: HGNC:1041
Homologene: 20791
Kplce
Name: KPRP N-terminal and LCE C-terminal like protein
Synonyms: 2310050C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66533
Homologene: 104374
Fxn
Name: frataxin
Synonyms: Frda
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14297
HGNC: HGNC:3951
Homologene: 47908
Or5ak20
Name: olfactory receptor family 5 subfamily AK member 20
Synonyms: GA_x6K02T2Q125-46830591-46829662, MOR203-5P, Olfr988
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258166
Homologene: 103791
Or5b12b
Name: olfactory receptor family 5 subfamily B member 12B
Synonyms: GA_x6K02T2RE5P-3213352-3214296, MOR202-7, Olfr1445
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258694
Homologene: 133606
Cant1
Name: calcium activated nucleotidase 1
Synonyms: 5830420C20Rik, Apy1h, Shapy, D11Bwg0554e, SCAN-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76025
Homologene: 69460
Or2b6
Name: olfactory receptor family 2 subfamily B member 6
Synonyms: MOR256-11, GA_x6K02T2QHY8-11597382-11598323, Olfr11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218066
HGNC: HGNC:8241
Homologene: 40838
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: Tac2-N, 4933406D09Rik, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Mylk4
Name: myosin light chain kinase family, member 4
Synonyms: EG238564
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238564
Homologene: 66243
Slc6a20b
Name: solute carrier family 6 (neurotransmitter transporter), member 20B
Synonyms: XT3, Xtrp3, Sit1, Slc6a20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22599
Homologene: 130652
Terb1
Name: telomere repeat binding bouquet formation protein 1
Synonyms: 4930532D21Rik, Ccdc79
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320022
Homologene: 18330
Cfap298
Name: cilia and flagella associate protien 298
Synonyms: 1110004E09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68001
HGNC: HGNC:1301
Homologene: 10941
Fbxo10
Name: F-box protein 10
Synonyms: FBX10, LOC269529
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269529
Homologene: 19544
Vstm5
Name: V-set and transmembrane domain containing 5
Synonyms: 2200002K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69137
VEGA: 9
Homologene: 45982
Trdv1
Name: T cell receptor delta variable 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 627813
Trim12a
Name: tripartite motif-containing 12A
Synonyms: 2310043C01Rik, Trim12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76681
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,100,823 bp
  • A to G, chromosome 1 at 92,916,895 bp
  • A to G, chromosome 1 at 174,192,966 bp
  • C to T, chromosome 1 at 189,863,228 bp
  • A to G, chromosome 2 at 12,194,420 bp
  • T to G, chromosome 2 at 85,353,915 bp
  • A to G, chromosome 2 at 130,504,299 bp
  • A to G, chromosome 2 at 140,230,873 bp
  • A to G, chromosome 3 at 58,629,845 bp
  • A to G, chromosome 3 at 92,868,615 bp
  • A to T, chromosome 3 at 95,071,918 bp
  • A to T, chromosome 4 at 28,942,648 bp
  • A to G, chromosome 4 at 45,058,531 bp
  • A to G, chromosome 4 at 152,052,065 bp
  • T to C, chromosome 4 at 155,654,933 bp
  • A to T, chromosome 5 at 84,086,364 bp
  • T to C, chromosome 5 at 129,746,473 bp
  • C to T, chromosome 5 at 142,114,574 bp
  • C to T, chromosome 7 at 45,549,274 bp
  • A to G, chromosome 7 at 47,235,049 bp
  • T to A, chromosome 7 at 104,304,192 bp
  • T to C, chromosome 7 at 112,067,191 bp
  • T to C, chromosome 7 at 127,194,791 bp
  • A to G, chromosome 8 at 33,610,677 bp
  • T to A, chromosome 8 at 94,300,850 bp
  • T to A, chromosome 8 at 104,472,884 bp
  • G to A, chromosome 9 at 15,257,797 bp
  • T to C, chromosome 9 at 89,994,835 bp
  • T to A, chromosome 9 at 103,426,777 bp
  • ACCTCCTCCTCCTCCTCCTCCTCCTC to ACCTCCTCCTCCTCCTCCTCCTC, chromosome 9 at 106,753,992 bp
  • T to C, chromosome 9 at 108,084,340 bp
  • C to T, chromosome 9 at 108,335,153 bp
  • T to A, chromosome 9 at 123,598,588 bp
  • T to C, chromosome 10 at 78,051,916 bp
  • A to G, chromosome 10 at 130,017,688 bp
  • G to T, chromosome 11 at 87,638,184 bp
  • A to T, chromosome 11 at 118,408,841 bp
  • A to G, chromosome 11 at 119,916,736 bp
  • T to C, chromosome 12 at 38,438,528 bp
  • G to A, chromosome 12 at 101,706,544 bp
  • C to T, chromosome 13 at 13,709,341 bp
  • A to T, chromosome 13 at 21,639,385 bp
  • T to C, chromosome 13 at 32,722,013 bp
  • T to G, chromosome 13 at 38,176,407 bp
  • T to C, chromosome 13 at 49,661,999 bp
  • A to T, chromosome 13 at 50,467,417 bp
  • A to T, chromosome 13 at 74,662,405 bp
  • A to G, chromosome 13 at 112,383,505 bp
  • A to G, chromosome 14 at 53,881,921 bp
  • T to C, chromosome 16 at 49,109,251 bp
  • T to C, chromosome 16 at 90,926,090 bp
  • T to A, chromosome 17 at 7,741,772 bp
  • T to A, chromosome 17 at 31,105,517 bp
  • T to A, chromosome 17 at 78,975,554 bp
  • C to T, chromosome 17 at 81,648,553 bp
  • A to G, chromosome 18 at 42,325,957 bp
  • T to A, chromosome 19 at 12,884,255 bp
  • T to A, chromosome 19 at 24,280,489 bp
  • T to G, chromosome 19 at 24,899,855 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2187 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040189-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.