Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2191Btlr/Mmmh
Stock Number:
040193-MU
Citation ID:
RRID:MMRRC_040193-MU
Other Names:
R2191 (G1), C57BL/6J-MtgxR2191Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Chrna3
Name: cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms: (a)3, alpha 3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, Acra-3, Acra3, A730007P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110834
VEGA: 9
HGNC: HGNC:1957
Homologene: 591
Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 3110009L02Rik, 2310045K21Rik, Lars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,605,875 bp
  • A to T, chromosome 1 at 78,699,140 bp
  • A to G, chromosome 1 at 83,192,663 bp
  • G to A, chromosome 1 at 93,751,587 bp
  • A to G, chromosome 1 at 97,744,110 bp
  • T to A, chromosome 1 at 151,796,883 bp
  • G to T, chromosome 1 at 154,443,845 bp
  • T to C, chromosome 1 at 165,422,864 bp
  • T to A, chromosome 1 at 195,163,381 bp
  • T to C, chromosome 2 at 76,707,134 bp
  • CTT to CTTT, chromosome 2 at 120,191,199 bp
  • A to T, chromosome 2 at 120,926,047 bp
  • T to C, chromosome 2 at 156,276,654 bp
  • T to C, chromosome 3 at 16,203,211 bp
  • T to A, chromosome 3 at 19,134,061 bp
  • T to C, chromosome 3 at 151,517,389 bp
  • C to G, chromosome 4 at 12,069,413 bp
  • C to T, chromosome 4 at 41,118,720 bp
  • C to A, chromosome 4 at 43,245,566 bp
  • G to C, chromosome 4 at 45,044,811 bp
  • T to A, chromosome 4 at 61,518,004 bp
  • G to A, chromosome 4 at 155,847,816 bp
  • C to T, chromosome 5 at 14,713,848 bp
  • A to T, chromosome 5 at 146,168,871 bp
  • A to G, chromosome 6 at 23,078,866 bp
  • T to G, chromosome 6 at 24,134,397 bp
  • G to A, chromosome 6 at 41,418,501 bp
  • G to T, chromosome 6 at 41,616,085 bp
  • T to C, chromosome 6 at 43,116,065 bp
  • A to T, chromosome 6 at 55,967,719 bp
  • T to C, chromosome 6 at 90,108,139 bp
  • C to T, chromosome 6 at 113,111,429 bp
  • G to A, chromosome 7 at 4,543,089 bp
  • A to G, chromosome 7 at 6,231,443 bp
  • G to A, chromosome 7 at 14,581,088 bp
  • A to T, chromosome 7 at 20,023,662 bp
  • T to A, chromosome 7 at 35,794,843 bp
  • C to T, chromosome 7 at 75,124,088 bp
  • GCG to GCGACGGCGACG, chromosome 7 at 97,579,907 bp
  • C to T, chromosome 8 at 46,013,169 bp
  • C to T, chromosome 8 at 81,997,302 bp
  • A to G, chromosome 8 at 95,761,426 bp
  • A to C, chromosome 8 at 110,894,725 bp
  • A to G, chromosome 9 at 20,920,221 bp
  • A to T, chromosome 9 at 39,060,405 bp
  • T to A, chromosome 9 at 55,016,045 bp
  • T to G, chromosome 9 at 67,355,221 bp
  • G to A, chromosome 9 at 78,328,175 bp
  • A to T, chromosome 9 at 79,774,307 bp
  • A to G, chromosome 9 at 83,862,183 bp
  • A to T, chromosome 9 at 110,086,118 bp
  • A to C, chromosome 10 at 13,128,941 bp
  • C to T, chromosome 10 at 127,888,598 bp
  • A to T, chromosome 11 at 4,499,032 bp
  • T to C, chromosome 11 at 60,220,539 bp
  • A to G, chromosome 11 at 77,818,615 bp
  • A to C, chromosome 11 at 103,618,967 bp
  • A to G, chromosome 11 at 118,285,023 bp
  • T to C, chromosome 12 at 8,922,296 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 44,207,073 bp
  • A to T, chromosome 12 at 80,171,802 bp
  • G to A, chromosome 12 at 80,662,527 bp
  • T to A, chromosome 12 at 82,396,691 bp
  • T to C, chromosome 12 at 111,097,627 bp
  • A to C, chromosome 12 at 118,867,956 bp
  • T to C, chromosome 13 at 23,099,233 bp
  • T to C, chromosome 13 at 81,566,290 bp
  • A to T, chromosome 14 at 31,142,800 bp
  • T to C, chromosome 14 at 31,159,270 bp
  • A to T, chromosome 15 at 6,759,614 bp
  • G to T, chromosome 15 at 69,092,960 bp
  • G to T, chromosome 15 at 76,632,680 bp
  • G to A, chromosome 15 at 86,129,608 bp
  • A to T, chromosome 15 at 98,861,049 bp
  • C to T, chromosome 16 at 4,770,063 bp
  • A to C, chromosome 16 at 15,698,824 bp
  • A to T, chromosome 16 at 59,085,675 bp
  • T to C, chromosome 17 at 20,502,885 bp
  • T to C, chromosome 17 at 32,415,957 bp
  • T to C, chromosome 17 at 34,626,791 bp
  • T to A, chromosome 17 at 34,903,002 bp
  • A to G, chromosome 17 at 78,773,677 bp
  • A to G, chromosome 17 at 84,446,521 bp
  • T to C, chromosome 17 at 90,701,976 bp
  • A to G, chromosome 17 at 93,200,026 bp
  • T to C, chromosome 18 at 20,409,618 bp
  • C to G, chromosome 18 at 21,235,990 bp
  • A to T, chromosome 18 at 42,212,616 bp
  • G to A, chromosome 18 at 80,753,051 bp
  • T to C, chromosome 18 at 89,095,648 bp
  • A to T, chromosome 19 at 4,356,931 bp
  • A to G, chromosome 19 at 7,095,829 bp
  • C to A, chromosome X at 49,783,150 bp
  • T to A, chromosome X at 56,504,750 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2191 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040193-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.