Strain Name:
C57BL/6J-MtgxR2191Btlr/Mmmh
Stock Number:
040193-MU
Citation ID:
RRID:MMRRC_040193-MU
Other Names:
R2191 (G1), C57BL/6J-MtgxR2191Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72895
Homologene: 12485
Mtmr3
Name: myotubularin related protein 3
Synonyms: 1700092A20Rik, ZFYVE10, FYVE-DSP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Chrna3
Name: cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms: Acra3, A730007P14Rik, alpha 3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, Acra-3, (a)3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110834
VEGA: 9
HGNC: HGNC:1957
Homologene: 591
Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 2310045K21Rik, Lars, 3110009L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: D530039E11Rik, 4921505C17Rik, 6030405M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228829
Homologene: 9507
Dnmt1
Name: DNA methyltransferase (cytosine-5) 1
Synonyms: MTase, MommeD2, Dnmt1o, Cxxc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Adcyap1
Name: adenylate cyclase activating polypeptide 1
Synonyms: PACAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11516
VEGA: 17
HGNC: HGNC:241
Homologene: 869
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DOXNPH, XRCC7, dxnph, DNA-PK, slip, DNAPDcs, DNA-PKcs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Armc1
Name: armadillo repeat containing 1
Synonyms: 2310016N05Rik, Arcp, 3110009G21Rik, C330014L16Rik, 2900046P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74252
Homologene: 10015
Ythdf3
Name: YTH N6-methyladenosine RNA binding protein 3
Synonyms: 9130022A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229096
Homologene: 34991
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22222
Homologene: 7582
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 360013
Homologene: 7977
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Rttn
Name: rotatin
Synonyms: C530033I08Rik, 4921538A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22137
Homologene: 2489
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Laptm4a
Name: lysosomal-associated protein transmembrane 4A
Synonyms: Mtrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 17775
HGNC: HGNC:6924
Homologene: 7427
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230082
Homologene: 41505
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: Nfkbil2, 2810439M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Garem1
Name: GRB2 associated regulator of MAPK1 subtype 1
Synonyms: Garem, LOC381126, Fam59a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381126
VEGA: 18
Homologene: 11237
Ehmt2
Name: euchromatic histone lysine N-methyltransferase 2
Synonyms: NG36, Bat8, D17Ertd710e, G9a, KMT1C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 110147
Homologene: 48460
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7a, Dnahc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Flrt1
Name: fibronectin leucine rich transmembrane protein 1
Synonyms: D630040I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 396184
VEGA: 19
HGNC: HGNC:3760
Homologene: 40864
Rcor1
Name: REST corepressor 1
Synonyms: 6720480E22Rik, D12Wsu95e, Rocr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217864
Homologene: 32246
Adgrl4
Name: adhesion G protein-coupled receptor L4
Synonyms: Etl, EGF-TM7 receptor, Eltd1, 1110033N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170757
Homologene: 11170
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: ADD-1, SREBP-1a, SREBP-1c, bHLHd1, SREBP1c, SREBP1, SREBP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20787
Homologene: 3079
Dnajb9
Name: DnaJ heat shock protein family (Hsp40) member B9
Synonyms: Mdg1, mDj7, microvascular endothelial differentiation gene, ERdj4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 27362
VEGA: 12
HGNC: HGNC:6968
Homologene: 32155
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66967
Homologene: 11866
Slc39a9
Name: solute carrier family 39 (zinc transporter), member 9
Synonyms: 4833420E20Rik, 2010002A02Rik, 2610511I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 328133
VEGA: 12
Homologene: 6935
Zfp507
Name: zinc finger protein 507
Synonyms: 1810022O10Rik, A230056M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 668501
Homologene: 8942
Dcaf6
Name: DDB1 and CUL4 associated factor 6
Synonyms: Iqwd1, PC326, 1200006M05Rik, NRIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74106
Homologene: 10199
Acsl3
Name: acyl-CoA synthetase long-chain family member 3
Synonyms: C85929, Facl3, 2610510B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74205
HGNC: HGNC:3570
Homologene: 3278
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Vip2, Hisppd1, Cfap160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227399
Homologene: 49409
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: 2010013B10Rik, A230048G03Rik, D330050P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Pglyrp2
Name: peptidoglycan recognition protein 2
Synonyms: Pglyrpl, tagL, PGRP-L, tagL-alpha, C730002N09Rik, tagl-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57757
VEGA: 17
Homologene: 49671
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Fbl7, Gm4560, Jhdm1a, 5530401A10Rik, Fbxl11, lalina, Cxxc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225876
Homologene: 56564
Sv2b
Name: synaptic vesicle glycoprotein 2b
Synonyms: A830038F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 64176
Homologene: 32236
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: 2310026J01Rik, Pla2epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329502
Homologene: 65339
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26875
Homologene: 69111
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22249
Homologene: 31376
Fcsk
Name: fucose kinase
Synonyms: Fuk, 1110046B12Rik, L-fucose kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234730
Homologene: 15452
Khdrbs3
Name: KH domain containing, RNA binding, signal transduction associated 3
Synonyms: SLM-2, Salp, T-STAR, Etle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 13992
VEGA: 15
Homologene: 4780
Lrp2bp
Name: Lrp2 binding protein
Synonyms: 4930479L12Rik, MegBP, 1700113N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67620
Homologene: 10183
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mass1, Gpr98, Mgr1, VLGR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Ephb6
Name: Eph receptor B6
Synonyms: Cekl, Mep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13848
HGNC: HGNC:3396
Homologene: 20940
Vmn1r50
Name: vomeronasal 1 receptor 50
Synonyms: V1rb1, VN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113852
Homologene: 113975
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243874
Homologene: 18530
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: Gm884, LOC380730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380730
Homologene: 134511
Daw1
Name: dynein assembly factor with WDR repeat domains 1
Synonyms: b2b1116Clo, b2b1584Clo, 4930563E19Rik, Wdr69, 4933429D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71227
Atg4b
Name: autophagy related 4B, cysteine peptidase
Synonyms: 2510009N07Rik, autophagin 1, Apg4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66615
Homologene: 100868
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 192187
Homologene: 9035
Gramd4
Name: GRAM domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223752
Homologene: 18199
Abcb5
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Tmem30a
Name: transmembrane protein 30A
Synonyms: 2010200I23Rik, Cdc50a, D9Wsu20e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69981
Homologene: 110703
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Dhx30
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 30
Synonyms: 2810477H02Rik, C130058C04Rik, helG, Ddx30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72831
Homologene: 15779
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171279
Homologene: 110880
Or8g23
Name: olfactory receptor family 8 subfamily G member 23
Synonyms: MOR171-24, GA_x6K02T2PVTD-32756567-32755632, Olfr937
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258431
VEGA: 9
HGNC: HGNC:8484
Homologene: 27167
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: alpha1E, Cchra1, Cav2.3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Nrxn1
Name: neurexin I
Synonyms: neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I alpha, 9330127H16Rik, alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, A230068P09Rik, neurexin I alpha, 1700062G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: D530004J12Rik, Ccdc129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232016
Homologene: 52344
Or5h23
Name: olfactory receptor family 5 subfamily H member 23
Synonyms: MOR183-5P, Olfr191, GA_x54KRFPKG5P-55314632-55313703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258035
Homologene: 128162
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329795
Homologene: 71886
Slc13a1
Name: solute carrier family 13 (sodium/sulfate symporters), member 1
Synonyms: Nas1, NaSi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 55961
Homologene: 31893
Ints6l
Name: integrator complex subunit 6 like
Synonyms: 6330505F04Rik, Ddx26b, 4930535D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236790
Homologene: 52110
Rdh7
Name: retinol dehydrogenase 7
Synonyms: CRAD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 54150
Homologene: 137324
Syt5
Name: synaptotagmin V
Synonyms: SytIX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53420
Homologene: 55722
Vmn1r90
Name: vomeronasal 1 receptor 90
Synonyms: B430211C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 627280
Homologene: 122945
Cr2
Name: complement receptor 2
Synonyms: C3DR, Cr-1, CD35, Cr1, CD21, Cr-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Or2a54
Name: olfactory receptor family 2 subfamily A member 54
Synonyms: Olfr441, MOR261-3, GA_x6K02T2P3E9-4442577-4441645
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258649
Homologene: 88438
Usp36
Name: ubiquitin specific peptidase 36
Synonyms: 2700002L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72344
Homologene: 11828
Omt2b
Name: oocyte maturation, beta
Synonyms: OM2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382088
Homologene: 136010
Zscan5b
Name: zinc finger and SCAN domain containing 5B
Synonyms: Zfg1, Zfp371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170734
Homologene: 129555
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13542
HGNC: HGNC:3084
Homologene: 20926
Vmn1r225
Name: vomeronasal 1 receptor 225
Synonyms: V1re5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171228
Ppt2
Name: palmitoyl-protein thioesterase 2
Synonyms: 0610007M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54397
HGNC: HGNC:9326
Homologene: 10448
Fbxo10
Name: F-box protein 10
Synonyms: LOC269529, FBX10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269529
Homologene: 19544
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Igsf1
Name: immunoglobulin superfamily, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 209268
HGNC: HGNC:5948
Homologene: 1195
Cdip1
Name: cell death inducing Trp53 target 1
Synonyms: 2700048O17Rik, 5730403B10Rik, CDIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66626
Homologene: 40879
Gm6309
Name: predicted gene 6309
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 622306
Homologene: 86127
Mup16
Name: major urinary protein 16
Synonyms: Gm2083
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100039177
Homologene: 74304
Gm5409
Name: predicted pseudogene 5409
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 386551
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,605,875 bp
  • A to T, chromosome 1 at 78,699,140 bp
  • A to G, chromosome 1 at 83,192,663 bp
  • G to A, chromosome 1 at 93,751,587 bp
  • A to G, chromosome 1 at 97,744,110 bp
  • T to A, chromosome 1 at 151,796,883 bp
  • G to T, chromosome 1 at 154,443,845 bp
  • T to C, chromosome 1 at 165,422,864 bp
  • T to A, chromosome 1 at 195,163,381 bp
  • T to C, chromosome 2 at 76,707,134 bp
  • CTT to CTTT, chromosome 2 at 120,191,199 bp
  • A to T, chromosome 2 at 120,926,047 bp
  • T to C, chromosome 2 at 156,276,654 bp
  • T to C, chromosome 3 at 16,203,211 bp
  • T to A, chromosome 3 at 19,134,061 bp
  • T to C, chromosome 3 at 151,517,389 bp
  • C to G, chromosome 4 at 12,069,413 bp
  • C to T, chromosome 4 at 41,118,720 bp
  • C to A, chromosome 4 at 43,245,566 bp
  • G to C, chromosome 4 at 45,044,811 bp
  • T to A, chromosome 4 at 61,518,004 bp
  • G to A, chromosome 4 at 155,847,816 bp
  • C to T, chromosome 5 at 14,713,848 bp
  • A to T, chromosome 5 at 146,168,871 bp
  • A to G, chromosome 6 at 23,078,866 bp
  • T to G, chromosome 6 at 24,134,397 bp
  • G to A, chromosome 6 at 41,418,501 bp
  • G to T, chromosome 6 at 41,616,085 bp
  • T to C, chromosome 6 at 43,116,065 bp
  • A to T, chromosome 6 at 55,967,719 bp
  • T to C, chromosome 6 at 90,108,139 bp
  • C to T, chromosome 6 at 113,111,429 bp
  • G to A, chromosome 7 at 4,543,089 bp
  • A to G, chromosome 7 at 6,231,443 bp
  • G to A, chromosome 7 at 14,581,088 bp
  • A to T, chromosome 7 at 20,023,662 bp
  • T to A, chromosome 7 at 35,794,843 bp
  • C to T, chromosome 7 at 75,124,088 bp
  • GCG to GCGACGGCGACG, chromosome 7 at 97,579,907 bp
  • C to T, chromosome 8 at 46,013,169 bp
  • C to T, chromosome 8 at 81,997,302 bp
  • A to G, chromosome 8 at 95,761,426 bp
  • A to C, chromosome 8 at 110,894,725 bp
  • A to G, chromosome 9 at 20,920,221 bp
  • A to T, chromosome 9 at 39,060,405 bp
  • T to A, chromosome 9 at 55,016,045 bp
  • T to G, chromosome 9 at 67,355,221 bp
  • G to A, chromosome 9 at 78,328,175 bp
  • A to T, chromosome 9 at 79,774,307 bp
  • A to G, chromosome 9 at 83,862,183 bp
  • A to T, chromosome 9 at 110,086,118 bp
  • A to C, chromosome 10 at 13,128,941 bp
  • C to T, chromosome 10 at 127,888,598 bp
  • A to T, chromosome 11 at 4,499,032 bp
  • T to C, chromosome 11 at 60,220,539 bp
  • A to G, chromosome 11 at 77,818,615 bp
  • A to C, chromosome 11 at 103,618,967 bp
  • A to G, chromosome 11 at 118,285,023 bp
  • T to C, chromosome 12 at 8,922,296 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to C, chromosome 12 at 44,207,073 bp
  • A to T, chromosome 12 at 80,171,802 bp
  • G to A, chromosome 12 at 80,662,527 bp
  • T to A, chromosome 12 at 82,396,691 bp
  • T to C, chromosome 12 at 111,097,627 bp
  • A to C, chromosome 12 at 118,867,956 bp
  • T to C, chromosome 13 at 23,099,233 bp
  • T to C, chromosome 13 at 81,566,290 bp
  • A to T, chromosome 14 at 31,142,800 bp
  • T to C, chromosome 14 at 31,159,270 bp
  • A to T, chromosome 15 at 6,759,614 bp
  • G to T, chromosome 15 at 69,092,960 bp
  • G to T, chromosome 15 at 76,632,680 bp
  • G to A, chromosome 15 at 86,129,608 bp
  • A to T, chromosome 15 at 98,861,049 bp
  • C to T, chromosome 16 at 4,770,063 bp
  • A to C, chromosome 16 at 15,698,824 bp
  • A to T, chromosome 16 at 59,085,675 bp
  • T to C, chromosome 17 at 20,502,885 bp
  • T to C, chromosome 17 at 32,415,957 bp
  • T to C, chromosome 17 at 34,626,791 bp
  • T to A, chromosome 17 at 34,903,002 bp
  • A to G, chromosome 17 at 78,773,677 bp
  • A to G, chromosome 17 at 84,446,521 bp
  • T to C, chromosome 17 at 90,701,976 bp
  • A to G, chromosome 17 at 93,200,026 bp
  • T to C, chromosome 18 at 20,409,618 bp
  • C to G, chromosome 18 at 21,235,990 bp
  • A to T, chromosome 18 at 42,212,616 bp
  • G to A, chromosome 18 at 80,753,051 bp
  • T to C, chromosome 18 at 89,095,648 bp
  • A to T, chromosome 19 at 4,356,931 bp
  • A to G, chromosome 19 at 7,095,829 bp
  • C to A, chromosome X at 49,783,150 bp
  • T to A, chromosome X at 56,504,750 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2191 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040193-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.