Strain Name:
C57BL/6J-MtgxR2298Btlr/Mmmh
Stock Number:
040297-MU
Citation ID:
RRID:MMRRC_040297-MU
Other Names:
R2298 (G1), C57BL/6J-MtgxR2298Btlr
Major Collection:

Strain Information

Traf4
Name: TNF receptor associated factor 4
Synonyms: CART1, msp2, A530032M13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22032
Homologene: 3173
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: Her4, ErbB4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Rps6ka5
Name: ribosomal protein S6 kinase, polypeptide 5
Synonyms: MSK1, 3110005L17Rik, 6330404E13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73086
VEGA: 12
Homologene: 48302
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: 2810429C13Rik, 1110031N14Rik, D430026L04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: 2610040L17Rik, Odz2, D3Bwg1534e, Ten-m2, 9330187F13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Cramp1
Name: cramped chromatin regulator 1
Synonyms: Cramp1l, Tce4, 5830477H08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57354
VEGA: 17
Homologene: 35373
Atcay
Name: ataxia, cerebellar, Cayman type
Synonyms: BNIP-H, ji, 3322401A10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16467
HGNC: HGNC:779
Homologene: 13206
Klf13
Name: Kruppel-like transcription factor 13
Synonyms: 9430029L20Rik, RFLAT1, FKLF-2, RFLAT-1, Bteb3, NSLP1, Klf13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50794
Homologene: 32288
H3f3a
Name: H3.3 histone A
Synonyms: H3.3A, H3-3a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15078
Homologene: 134170
Sec22b
Name: SEC22 homolog B, vesicle trafficking protein
Synonyms: ERS-24, 4930564D15Rik, Sec22l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20333
Homologene: 3597
Kremen1
Name: kringle containing transmembrane protein 1
Synonyms: Krm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 84035
Homologene: 12935
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Ngfr
Name: nerve growth factor receptor (TNFR superfamily, member 16)
Synonyms: p75 neurotrophin receptor, p75, Tnfrsf16, LNGFR, p75NTR, p75NGFR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18053
HGNC: HGNC:7809
Homologene: 1877
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Phf8l
Name: PHD finger protein 8 like
Synonyms: 4921501E09Rik, Phf8-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74042
VEGA: 17
Homologene: 66275
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Capn8
Name: calpain 8
Synonyms: nCL-2', nCL-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Lgmn
Name: legumain
Synonyms: Prsc1, preprolegumain, AEP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19141
HGNC: HGNC:9472
Homologene: 38075
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, Endo180, novel lectin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
1700030K09Rik
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72254
Homologene: 12975
Abhd12
Name: abhydrolase domain containing 12
Synonyms: 6330583M11Rik, 1500011G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76192
Homologene: 22910
Srl
Name: sarcalumenin
Synonyms: sar, 9830004M20Rik, sarcalumenin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106393
Homologene: 45500
Myzap
Name: myocardial zonula adherens protein
Synonyms: Myozap, Gcom1, Grinl1a7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102371
Homologene: 134156
Ppp1r14d
Name: protein phosphatase 1, regulatory inhibitor subunit 14D
Synonyms: 2010107K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72112
Homologene: 9800
Trpv6
Name: transient receptor potential cation channel, subfamily V, member 6
Synonyms: Ecac2, CaT1, Cac, CAT
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64177
Homologene: 56812
Galm
Name: galactose mutarotase
Synonyms: aldose 1-epimerase, A530057M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319625
Homologene: 71795
Zfp768
Name: zinc finger protein 768
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233890
Homologene: 11650
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 68,042,531 bp
  • C to T, chromosome 1 at 180,803,138 bp
  • T to C, chromosome 1 at 182,613,420 bp
  • G to A, chromosome 2 at 3,429,364 bp
  • G to A, chromosome 2 at 91,991,976 bp
  • A to G, chromosome 2 at 119,218,672 bp
  • C to A, chromosome 2 at 150,901,494 bp
  • T to C, chromosome 3 at 97,914,495 bp
  • G to A, chromosome 4 at 141,025,459 bp
  • A to G, chromosome 6 at 41,636,076 bp
  • T to C, chromosome 7 at 63,891,756 bp
  • T to A, chromosome 7 at 127,344,189 bp
  • A to G, chromosome 8 at 72,455,403 bp
  • A to T, chromosome 9 at 71,548,757 bp
  • C to T, chromosome 9 at 103,320,344 bp
  • A to G, chromosome 10 at 43,999,222 bp
  • A to T, chromosome 10 at 81,210,563 bp
  • T to A, chromosome 10 at 86,954,474 bp
  • AGGCGG to AGGCGGCGG, chromosome 11 at 5,201,788 bp
  • T to C, chromosome 11 at 36,046,777 bp
  • T to A, chromosome 11 at 78,160,851 bp
  • AAGCAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAGCAG, chromosome 11 at 95,587,490 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to A, chromosome 11 at 120,813,816 bp
  • A to G, chromosome 12 at 100,551,454 bp
  • A to G, chromosome 12 at 102,395,678 bp
  • T to C, chromosome 16 at 4,482,898 bp
  • C to T, chromosome 16 at 22,805,551 bp
  • T to C, chromosome 17 at 24,997,480 bp
  • T to C, chromosome 17 at 33,066,778 bp
  • T to A, chromosome 17 at 80,181,697 bp
  • T to A, chromosome 17 at 87,708,502 bp
  • G to T, chromosome 18 at 74,625,605 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040297-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.