Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2372Btlr/Mmmh
Stock Number:
040352-MU
Citation ID:
RRID:MMRRC_040352-MU
Other Names:
R2372 (G1), C57BL/6J-MtgxR2372Btlr
Major Collection:

Strain Information

Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Rbpj
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: CBF1, Igkrsbp, RBP-J kappa, RBPjk, Igkjrb, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
HGNC: HGNC:5724
Homologene: 7511
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, ATP2C1A, PMR1, 1700121J11Rik, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Ccdc15
Name: coiled-coil domain containing 15
Synonyms: A630039F14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245902
VEGA: 9
Homologene: 28448
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Eef1d
Name: eukaryotic translation elongation factor 1 delta
Synonyms: 5730529A16Rik, 1700026P12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66656
HGNC: HGNC:3211
Homologene: 23404
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Gsx2
Name: GS homeobox 2
Synonyms: Gsh-2, Gsh2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14843
Homologene: 15377
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Fyb1
Name: FYN binding protein 1
Synonyms: FYB-120/130, ADAP, B630013F22Rik, Fyb
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23880
HGNC: HGNC:4036
Homologene: 22664
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Cimap1a
Name: ciliary microtubule associated protein 1A
Synonyms: SHIPPO1, 1700011O04Rik, Odf3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69287
Homologene: 12306
Alpi
Name: alkaline phosphatase, intestinal
Synonyms: 2010001C14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76768
Homologene: 122414
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Slc25a45
Name: solute carrier family 25, member 45
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107375
Homologene: 76679
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Iqsec1
Name: IQ motif and Sec7 domain 1
Synonyms: cI-43, D6Ertd349e, BRAG2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232227
Homologene: 82429
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Krtap4-23
Name: keratin associated protein 4-23
Synonyms: Gm11596
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 670464
Homologene: 124486
Cpb2
Name: carboxypeptidase B2
Synonyms: thrombin-activatable fibrinolysis inhibitor, CPU, carboxypeptidase U, TAFI, 1110032P04Rik, carboxypeptidase R, CPR, 4930405E17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56373
VEGA: 14
HGNC: HGNC:2300
Homologene: 55610
Sgip1
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73094
Homologene: 13001
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227394
Homologene: 62654
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20822
Homologene: 3383
Kif12
Name: kinesin family member 12
Synonyms: N-9 kinesin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16552
Homologene: 7796
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Use1
Name: unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Synonyms: 5730403H22Rik, D12, Q-SNARE, mED2, 2010315L10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67023
Homologene: 10214
N4bp2l1
Name: NEDD4 binding protein 2-like 1
Synonyms: B230342M21Rik, 2410024N18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100637
Homologene: 14151
Sh3bp2
Name: SH3-domain binding protein 2
Synonyms: 3BP2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24055
Homologene: 2276
Sult2a4
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
Synonyms: Gm5584
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434121
Homologene: 37741
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Dok6
Name: docking protein 6
Synonyms: Dok-6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 623279
Homologene: 45143
1700008O03Rik
Name: RIKEN cDNA 1700008O03 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69349
Homologene: 19260
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,780,052 bp
  • G to T, chromosome 1 at 87,100,594 bp
  • T to A, chromosome 1 at 96,821,200 bp
  • C to A, chromosome 1 at 143,770,882 bp
  • A to G, chromosome 2 at 164,895,039 bp
  • C to T, chromosome 4 at 43,650,432 bp
  • T to A, chromosome 4 at 63,168,559 bp
  • T to C, chromosome 4 at 102,909,791 bp
  • T to A, chromosome 4 at 112,019,151 bp
  • T to A, chromosome 4 at 129,118,444 bp
  • T to C, chromosome 4 at 136,933,010 bp
  • G to T, chromosome 5 at 32,984,040 bp
  • T to C, chromosome 5 at 34,559,496 bp
  • T to C, chromosome 5 at 53,642,195 bp
  • T to C, chromosome 5 at 75,077,052 bp
  • T to A, chromosome 5 at 142,759,704 bp
  • C to T, chromosome 5 at 150,572,781 bp
  • T to C, chromosome 6 at 88,485,797 bp
  • A to G, chromosome 6 at 90,694,654 bp
  • C to T, chromosome 6 at 128,580,386 bp
  • T to A, chromosome 7 at 13,915,300 bp
  • A to G, chromosome 7 at 44,360,280 bp
  • A to G, chromosome 7 at 118,853,217 bp
  • T to C, chromosome 7 at 140,848,600 bp
  • T to C, chromosome 8 at 71,369,179 bp
  • T to C, chromosome 9 at 37,315,505 bp
  • C to A, chromosome 9 at 42,388,274 bp
  • A to T, chromosome 9 at 105,418,529 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 11 at 49,807,715 bp
  • C to A, chromosome 11 at 99,793,256 bp
  • T to G, chromosome 14 at 75,268,050 bp
  • T to C, chromosome 15 at 6,651,907 bp
  • G to A, chromosome 15 at 75,896,317 bp
  • A to T, chromosome 16 at 45,774,932 bp
  • A to G, chromosome 18 at 10,812,045 bp
  • G to C, chromosome 18 at 89,414,864 bp
  • G to A, chromosome 19 at 5,884,552 bp
  • T to C, chromosome 19 at 43,902,320 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2372 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040352-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.