Strain Name:
C57BL/6J-MtgxR2434Btlr/Mmmh
Stock Number:
040395-MU
Citation ID:
RRID:MMRRC_040395-MU
Other Names:
R2434 (G1), C57BL/6J-MtgxR2434Btlr
Major Collection:

Strain Information

Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Tmem199
Name: transmembrane protein 199
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195040
Homologene: 45125
Eif3a
Name: eukaryotic translation initiation factor 3, subunit A
Synonyms: Eif3, Eif3s10, A830012B05Rik, Csma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13669
VEGA: 19
HGNC: HGNC:3271
Homologene: 2779
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: Rje, 1300019H17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, AnkG, 2900054D09Rik, Ankyrin-3, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
E2f5
Name: E2F transcription factor 5
Synonyms: E2F-5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13559
HGNC: HGNC:3119
Homologene: 1472
Fcrl2
Name: Fc receptor like 2
Synonyms: Fcrls, 2810439C17Rik, IFGP2, Msr2, Fcrh2, moFcRH2sc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80891
Homologene: 57117
Serinc4
Name: serine incorporator 4
Synonyms: A930015D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 574418
Homologene: 67424
Gipc2
Name: GIPC PDZ domain containing family, member 2
Synonyms: 2200002N01Rik, Semcap2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54120
Homologene: 22994
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: EGFL2, mfmi1, Adgrc2, flamingo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Stab2
Name: stabilin 2
Synonyms: FEEL-2, STAB-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Cpne8
Name: copine VIII
Synonyms: 1500031E20Rik, 1200003E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: E230029I04Rik, 2-5A-dependent RNAase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24014
Homologene: 8040
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: D16Ertd536e, 2310045H19Rik, 2810426P10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Or11l3
Name: olfactory receptor family 11 subfamily L member 3
Synonyms: Olfr323, GA_x6K02T2NKPP-794386-795357, MOR107-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258373
Homologene: 64865
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: cI-44, 4933402I15Rik, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67120
Homologene: 12085
St3gal6
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms: ST3Gal VI, 1700023B24Rik, Siat10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 54613
Homologene: 4448
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: TEG-23, Tex23
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235169
Homologene: 9712
Cpxm1
Name: carboxypeptidase X, M14 family member 1
Synonyms: Cpx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56264
Homologene: 10485
Agbl5
Name: ATP/GTP binding protein-like 5
Synonyms: 9430057O19Rik, Ccp5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231093
Homologene: 11053
Lgr5
Name: leucine rich repeat containing G protein coupled receptor 5
Synonyms: Gpr49
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14160
HGNC: HGNC:4504
Homologene: 20807
Slc47a1
Name: solute carrier family 47, member 1
Synonyms: MATE1, 1300013J15Rik, mMATE1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67473
Homologene: 34364
Capsl
Name: calcyphosine-like
Synonyms: 1700028N11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75568
VEGA: 15
Homologene: 16959
Vmn2r-ps158
Name: vomeronasal 2, receptor, pseudogene 158
Synonyms: Gm9268, Vmn2r126
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668612
Homologene: 104832
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226565
Homologene: 68130
Vmn1r205
Name: vomeronasal 1 receptor 205
Synonyms: V1rh8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171251
Homologene: 110880
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107239
VEGA: 19
Homologene: 26439
Efcab9
Name: EF-hand calcium binding domain 9
Synonyms: 1700007I06Rik, 4930403C08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69306
Homologene: 12309
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 153,754,650 bp
  • A to T, chromosome 1 at 162,916,870 bp
  • C to T, chromosome 2 at 121,455,705 bp
  • A to T, chromosome 2 at 130,394,084 bp
  • T to A, chromosome 3 at 14,579,014 bp
  • A to G, chromosome 3 at 33,801,078 bp
  • A to T, chromosome 3 at 55,647,460 bp
  • A to G, chromosome 3 at 87,256,698 bp
  • A to C, chromosome 3 at 108,404,479 bp
  • T to A, chromosome 3 at 152,137,680 bp
  • A to G, chromosome 5 at 30,894,013 bp
  • C to A, chromosome 5 at 74,546,824 bp
  • T to A, chromosome 6 at 91,735,212 bp
  • A to G, chromosome 7 at 43,047,457 bp
  • T to C, chromosome 7 at 44,333,420 bp
  • G to A, chromosome 7 at 126,371,165 bp
  • GTCCTCCTCCTCCTCCTCCTC to GTCCTCCTCCTCCTCCTC, chromosome 8 at 70,855,166 bp
  • G to T, chromosome 9 at 35,205,658 bp
  • T to A, chromosome 10 at 50,907,958 bp
  • T to C, chromosome 10 at 70,002,118 bp
  • G to A, chromosome 10 at 86,969,319 bp
  • T to A, chromosome 10 at 115,587,406 bp
  • T to C, chromosome 11 at 32,523,517 bp
  • A to G, chromosome 11 at 58,625,111 bp
  • A to T, chromosome 11 at 61,367,722 bp
  • T to C, chromosome 11 at 71,156,726 bp
  • G to A, chromosome 11 at 78,509,744 bp
  • T to A, chromosome 13 at 22,592,354 bp
  • A to T, chromosome 15 at 9,462,709 bp
  • T to C, chromosome 15 at 90,509,511 bp
  • T to C, chromosome 16 at 58,470,652 bp
  • T to A, chromosome 16 at 70,441,212 bp
  • G to T, chromosome 16 at 91,654,687 bp
  • A to C, chromosome 19 at 4,165,449 bp
  • T to C, chromosome 19 at 60,764,050 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2434 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040395-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.