Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2504Btlr/Mmmh
Stock Number:
040412-MU
Citation ID:
RRID:MMRRC_040412-MU
Other Names:
R2504 (G1), C57BL/6J-MtgxR2504Btlr
Major Collection:

Strain Information

Epha4
Name: Eph receptor A4
Synonyms: Sek, Sek1, Tyro1, Hek8, Cek8, 2900005C20Rik, rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Sstr2
Name: somatostatin receptor 2
Synonyms: SSTR-2, sst2, Smstr2, Smstr-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20606
Homologene: 37427
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,810,789 bp
  • G to A, chromosome 1 at 37,815,677 bp
  • A to C, chromosome 1 at 77,382,991 bp
  • G to A, chromosome 1 at 82,653,286 bp
  • A to G, chromosome 1 at 86,089,997 bp
  • A to T, chromosome 1 at 130,409,875 bp
  • A to G, chromosome 1 at 134,777,462 bp
  • G to T, chromosome 1 at 135,852,065 bp
  • A to T, chromosome 1 at 135,969,316 bp
  • A to G, chromosome 1 at 139,170,170 bp
  • A to T, chromosome 1 at 150,686,867 bp
  • A to G, chromosome 1 at 159,232,805 bp
  • A to G, chromosome 1 at 171,529,159 bp
  • A to T, chromosome 1 at 182,441,639 bp
  • T to C, chromosome 2 at 31,017,922 bp
  • T to A, chromosome 2 at 69,938,198 bp
  • G to A, chromosome 2 at 80,530,218 bp
  • G to A, chromosome 2 at 82,257,519 bp
  • T to C, chromosome 2 at 82,979,610 bp
  • A to T, chromosome 2 at 85,071,691 bp
  • G to A, chromosome 2 at 101,886,331 bp
  • T to C, chromosome 2 at 152,622,570 bp
  • A to G, chromosome 2 at 165,298,687 bp
  • G to T, chromosome 3 at 31,237,501 bp
  • A to T, chromosome 3 at 50,377,746 bp
  • T to A, chromosome 3 at 86,547,555 bp
  • G to A, chromosome 3 at 95,138,397 bp
  • A to T, chromosome 3 at 108,413,591 bp
  • T to C, chromosome 3 at 123,353,606 bp
  • A to C, chromosome 3 at 135,589,329 bp
  • T to C, chromosome 4 at 11,241,642 bp
  • A to G, chromosome 4 at 11,980,083 bp
  • T to C, chromosome 4 at 48,662,059 bp
  • A to T, chromosome 4 at 58,135,628 bp
  • T to A, chromosome 4 at 65,180,889 bp
  • A to G, chromosome 4 at 107,080,945 bp
  • T to A, chromosome 4 at 114,228,812 bp
  • G to T, chromosome 4 at 117,675,298 bp
  • A to G, chromosome 4 at 129,491,486 bp
  • G to T, chromosome 4 at 141,018,049 bp
  • A to T, chromosome 5 at 20,358,936 bp
  • G to T, chromosome 5 at 20,902,366 bp
  • T to C, chromosome 5 at 63,804,374 bp
  • T to C, chromosome 5 at 74,531,177 bp
  • T to C, chromosome 5 at 87,251,772 bp
  • T to A, chromosome 5 at 87,777,438 bp
  • G to A, chromosome 5 at 110,290,502 bp
  • A to G, chromosome 5 at 110,668,645 bp
  • T to C, chromosome 5 at 121,220,620 bp
  • T to C, chromosome 5 at 121,263,967 bp
  • C to T, chromosome 5 at 123,778,347 bp
  • A to T, chromosome 5 at 127,602,018 bp
  • A to T, chromosome 5 at 127,617,239 bp
  • A to G, chromosome 5 at 147,527,036 bp
  • A to T, chromosome 6 at 40,517,826 bp
  • A to G, chromosome 6 at 123,065,945 bp
  • A to G, chromosome 6 at 148,204,774 bp
  • C to T, chromosome 7 at 19,917,180 bp
  • T to A, chromosome 7 at 99,897,596 bp
  • T to C, chromosome 7 at 112,104,470 bp
  • T to A, chromosome 7 at 116,390,569 bp
  • T to C, chromosome 7 at 127,020,224 bp
  • T to G, chromosome 7 at 128,086,087 bp
  • T to A, chromosome 7 at 134,349,479 bp
  • A to G, chromosome 7 at 139,647,117 bp
  • T to C, chromosome 7 at 140,638,484 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • A to G, chromosome 8 at 91,280,716 bp
  • T to C, chromosome 9 at 82,915,339 bp
  • G to T, chromosome 9 at 100,866,210 bp
  • C to T, chromosome 10 at 81,499,304 bp
  • A to G, chromosome 11 at 40,687,589 bp
  • A to G, chromosome 11 at 43,491,156 bp
  • T to A, chromosome 11 at 72,317,285 bp
  • T to A, chromosome 11 at 99,317,296 bp
  • T to C, chromosome 11 at 102,255,296 bp
  • T to C, chromosome 11 at 105,385,572 bp
  • C to T, chromosome 11 at 111,025,583 bp
  • T to C, chromosome 11 at 113,624,431 bp
  • T to C, chromosome 11 at 120,018,855 bp
  • T to A, chromosome 12 at 30,003,406 bp
  • C to T, chromosome 12 at 40,081,706 bp
  • T to G, chromosome 12 at 81,379,137 bp
  • T to C, chromosome 12 at 98,844,105 bp
  • G to A, chromosome 13 at 46,814,200 bp
  • C to T, chromosome 13 at 60,782,654 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • A to G, chromosome 13 at 73,675,806 bp
  • A to G, chromosome 13 at 92,439,061 bp
  • A to T, chromosome 13 at 102,738,639 bp
  • A to G, chromosome 13 at 105,109,742 bp
  • T to C, chromosome 13 at 111,256,183 bp
  • A to G, chromosome 14 at 31,163,040 bp
  • C to T, chromosome 14 at 33,956,018 bp
  • A to T, chromosome 14 at 45,299,088 bp
  • A to T, chromosome 14 at 65,270,714 bp
  • G to T, chromosome 14 at 118,881,044 bp
  • A to G, chromosome 14 at 122,158,684 bp
  • G to A, chromosome 15 at 8,219,216 bp
  • T to C, chromosome 15 at 44,485,428 bp
  • A to T, chromosome 15 at 82,559,036 bp
  • A to T, chromosome 15 at 84,933,658 bp
  • A to G, chromosome 15 at 96,695,105 bp
  • C to T, chromosome 15 at 101,568,031 bp
  • A to G, chromosome 15 at 101,884,858 bp
  • A to T, chromosome 15 at 102,188,667 bp
  • G to A, chromosome 16 at 20,120,167 bp
  • C to T, chromosome 16 at 34,721,850 bp
  • T to A, chromosome 16 at 37,011,942 bp
  • A to G, chromosome 16 at 37,115,667 bp
  • A to G, chromosome 16 at 57,570,662 bp
  • A to T, chromosome 16 at 57,571,047 bp
  • T to A, chromosome 16 at 63,603,625 bp
  • C to A, chromosome 17 at 15,807,647 bp
  • T to C, chromosome 17 at 21,658,967 bp
  • G to A, chromosome 17 at 24,720,379 bp
  • T to A, chromosome 17 at 31,092,395 bp
  • C to T, chromosome 17 at 35,664,793 bp
  • T to A, chromosome 17 at 63,991,580 bp
  • C to T, chromosome 18 at 4,674,026 bp
  • C to A, chromosome 18 at 12,905,031 bp
  • C to T, chromosome 18 at 58,093,359 bp
  • A to C, chromosome 19 at 12,651,398 bp
  • T to C, chromosome 19 at 17,000,036 bp
  • G to A, chromosome 19 at 25,425,995 bp
  • A to G, chromosome 19 at 37,698,342 bp
  • A to T, chromosome 19 at 46,324,913 bp
  • T to C, chromosome X at 86,046,522 bp
  • T to A, chromosome X at 104,084,393 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2504 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040412-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.