Strain Name:
C57BL/6J-MtgxR2504Btlr/Mmmh
Stock Number:
040412-MU
Citation ID:
RRID:MMRRC_040412-MU
Other Names:
R2504 (G1), C57BL/6J-MtgxR2504Btlr
Major Collection:

Gene Information

Epha4
Name: Eph receptor A4
Synonyms: Tyro1, rb, 2900005C20Rik, Sek, Sek1, Hek8, Cek8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Sstr2
Name: somatostatin receptor 2
Synonyms: Smstr-2, SSTR-2, sst2, Smstr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20606
Homologene: 37427
Ptch1
Name: patched 1
Synonyms: Ptc1, Patched 1, A230106A15Rik, wig, Ptc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, mDomino, p400
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 75560
Homologene: 38779
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: G430090F17Rik, LOC328902
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 64291
Homologene: 84746
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 18983
Homologene: 49011
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 74996
Homologene: 9929
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Tm9sf2
Name: transmembrane 9 superfamily member 2
Synonyms: P76, D14Ertd64e, 1500001N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 68059
Homologene: 21004
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Mat2b
Name: methionine adenosyltransferase II, beta
Synonyms: MATIIbeta, 2410018D16Rik, 1110064C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 108645
HGNC: HGNC:6905
Homologene: 8323
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: nuclear factor kappaB p50, NF-kappaB p50, p50/p105, p50, NF-kappaB, NF kappaB1, p50 subunit of NF kappaB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Sec24d
Name: Sec24 related gene family, member D (S. cerevisiae)
Synonyms: LOC383951, 2310020L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 69608
Homologene: 40986
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Rfwd2, Cop1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 26374
Homologene: 115565
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 328329
Homologene: 42094
Psmd1
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms: P112, S1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70247
HGNC: HGNC:9554
Homologene: 2100
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 208628
Homologene: 32227
Nckap1
Name: NCK-associated protein 1
Synonyms: Hem-2, Nap1, H19, Hem2, mh19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 72656
Homologene: 9888
Fer
Name: fer (fms/fps related) protein kinase
Synonyms: Fert2, C330004K01Rik, Fert
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 83946
Homologene: 41209
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239839
VEGA: 16
Homologene: 32549
Klhl24
Name: kelch-like 24
Synonyms: 4930429H24Rik, 6530402O20Rik, 1110046J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 75785
VEGA: 16
Homologene: 32352
Slc38a2
Name: solute carrier family 38, member 2
Synonyms: 5033402L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 67760
VEGA: 15
Homologene: 23132
Csad
Name: cysteine sulfinic acid decarboxylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 246277
VEGA: 15
Homologene: 41086
Stag1
Name: stromal antigen 1
Synonyms: SA-1, Scc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 20842
Homologene: 21191
Pvr
Name: poliovirus receptor
Synonyms: mE4, Tage4, necl-5, 3830421F03Rik, Taa1, CD155, D7Ertd458e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 52118
HGNC: null
Homologene: 79541
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: Abc8, White
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 209456
Homologene: 3959
Commd9
Name: COMM domain containing 9
Synonyms: 1810029F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76501
Homologene: 8584
Dmap1
Name: DNA methyltransferase 1-associated protein 1
Synonyms: 1500016M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 66233
Homologene: 41311
Tmeff1
Name: transmembrane protein with EGF-like and two follistatin-like domains 1
Synonyms: tomoregulin-like, M7365
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230157
Homologene: 130458
Pan3
Name: PAN3 poly(A) specific ribonuclease subunit
Synonyms: A430027N15Rik, 2700050F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72587
Homologene: 6372
Jcad
Name: junctional cadherin 5 associated
Synonyms: 9430020K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 240185
VEGA: 18
Homologene: 19370
Krt25
Name: keratin 25
Synonyms: 4631426H08Rik, mIRSa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 70810
Homologene: 77127
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: C330002G24Rik, 8430412F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 242860
Homologene: 19435
Dennd1b
Name: DENN/MADD domain containing 1B
Synonyms: 4632404N19Rik, 4930467M19Rik, 6820401H01Rik, F730008N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329260
Homologene: 11739
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: Zfp650, 1110059H15Rik, 4833421P10Rik, A130030D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68795
Homologene: 52092
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: Ankrd15, D330024H06Rik, A930031B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 107351
Homologene: 17706
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218440
Homologene: 18450
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A230083H22Rik, A330102H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 353211
VEGA: 19
Homologene: 18939
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69183
Homologene: 12899
Itln1
Name: intelectin 1 (galactofuranose binding)
Synonyms: Itln2, Itlna, mLfR, IntL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16429
Homologene: 111044
Kif13a
Name: kinesin family member 13A
Synonyms: 4930505I07Rik, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16553
VEGA: 13
Homologene: 22589
Nup50
Name: nucleoporin 50
Synonyms: 1700030K07Rik, Npap60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18141
VEGA: 15
HGNC: HGNC:8065
Homologene: 5190
Ero1l
Name: ERO1-like (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 50527
VEGA: 14
Homologene: 49392
Slc15a4
Name: solute carrier family 15, member 4
Synonyms: C130069N12Rik, PTR4, PHT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100561
Homologene: 26432
BC030867
Name: cDNA sequence BC030867
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217216
Homologene: 69368
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319670
VEGA: 12
Homologene: 26807
Scfd2
Name: Sec1 family domain containing 2
Synonyms: E430013M20Rik, STXBP1L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 212986
Homologene: 77411
Tnks1bp1
Name: tankyrase 1 binding protein 1
Synonyms: TAB182
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228140
Homologene: 14117
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269700
Homologene: 28297
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 9530009M10Rik, 1810037O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Clec4b1
Name: C-type lectin domain family 4, member b1
Synonyms: DCARbeta, 1810046I24Rik, DCAR, mDcar2, 1810046I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 69810
Homologene: 130350
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Rbp-3, Irbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: alpha3(IV), tumstatin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: 9330101J02Rik, Ttc40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 212124
Homologene: null
Scin
Name: scinderin
Synonyms: adseverin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20259
Homologene: 36296
Itgam
Name: integrin alpha M
Synonyms: CD11B (p170), Mac-1, Ly-40, complement component receptor 3 alpha, Mac-1 alpha, Mac-1a, Cd11b, CR3, CD11b/CD18, complement receptor type 3, F730045J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 16409
HGNC: HGNC:6149
Homologene: 526
Rpgrip1l
Name: Rpgrip1-like
Synonyms: fantom, Ftm, 1700047E16Rik, Nphp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244585
Homologene: 18296
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545370
Homologene: 23741
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Psdl, 1110007H17Rik, Efa6, Efa6a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, End3, Hek, Hek4, Cek4, Mek4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, 4833413O10Rik, Polydom, D430029O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 64817
Homologene: 23386
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 50791
Homologene: 8189
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: Adgrc2, mfmi1, EGFL2, flamingo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, Xtrp2, D630001K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 22598
VEGA: 13
Homologene: 40785
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: Hug, Jbts17, b2b012Clo, 2410089E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 73692
Homologene: 11315
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241516
Homologene: 110349
Fbn2
Name: fibrillin 2
Synonyms: Sne, Fib-2, sy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241514
Homologene: 18461
Elmo2
Name: engulfment and cell motility 2
Synonyms: 1190002F24Rik, CED-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 140579
Homologene: 44338
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 192187
Homologene: 9035
Kcnj16
Name: potassium inwardly-rectifying channel, subfamily J, member 16
Synonyms: Kir5.1, 6430410F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16517
HGNC: HGNC:6262
Homologene: 23112
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: insulin level locus 1, tomosyn-2, t2md1, LLGL4, A830015P08Rik, T2dm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 207227
Homologene: 18173
Slc7a14
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 241919
Homologene: 76320
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 69675
Homologene: 33907
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 214321
HGNC: null
Homologene: 86950
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 112417
Homologene: 137225
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: IGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68915
Homologene: 57502
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Krt76
Name: keratin 76
Synonyms: 2310001L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 77055
Homologene: 22931
Usp20
Name: ubiquitin specific peptidase 20
Synonyms: Vdu2, 1700055M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 74270
Homologene: 4861
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319807
Homologene: 14974
Csn1s2a
Name: casein alpha s2-like A
Synonyms: Csng, Csn1s2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12993
Homologene: 7284
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226438
Homologene: 130054
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230872
Homologene: 16811
March10
Name: membrane-associated ring finger (C3HC4) 10
Synonyms: Rnf190, OTTMUSG00000002847, 4933417C16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 632687
Homologene: 34988
Defb25
Name: defensin beta 25
Synonyms: OTTMUSG00000015862
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 654459
Homologene: 134597
Prss37
Name: protease, serine 37
Synonyms: 1700016G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67690
Homologene: 12174
Cyp26a1
Name: cytochrome P450, family 26, subfamily a, polypeptide 1
Synonyms: Cyp26, P450RA, retinoic acid hydrolase, P450RAI, RAH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 13082
VEGA: 19
HGNC: HGNC:2603
Homologene: 37349
Zfp983
Name: zinc finger protein 983
Synonyms: 3110052M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 73229
VEGA: 17
HGNC: null
Homologene: null
Fbxo39
Name: F-box protein 39
Synonyms: 1700010H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 628100
Homologene: 15156
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2810422M04Rik, 2510025K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 66573
VEGA: 14
Homologene: 45708
Xrra1
Name: X-ray radiation resistance associated 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 446101
Homologene: 19547
Tsga10
Name: testis specific 10
Synonyms: Mtsga10, 4933432N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 211484
Homologene: 23531
D7Ertd443e
Name: DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms: 4933400E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71007
Homologene: 18998
Ergic2
Name: ERGIC and golgi 2
Synonyms: 4930572C01Rik, 1200009B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67456
Homologene: 6574
Mab21l2
Name: mab-21-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23937
HGNC: HGNC:6758
Homologene: 7824
Glyat
Name: glycine-N-acyltransferase
Synonyms: A330009E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 107146
Homologene: 64840
Cyp2d12
Name: cytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms: 9030605E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 380997
VEGA: 15
HGNC: null
Homologene: 86099
S1pr4
Name: sphingosine-1-phosphate receptor 4
Synonyms: lpC1, Edg6, S1P4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 13611
VEGA: 10
HGNC: HGNC:3170
Homologene: 2799
Slc7a11
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms: System xc, 9930009M05Rik, xc, xCT, sut
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 26570
Homologene: 22684
Krt75
Name: keratin 75
Synonyms: Krtcap1, Krt2-6hf, K6hf, 4732468K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 109052
Homologene: 20983
BC051665
Name: cDNA sequence BC051665
Synonyms: cathepsin L-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218275
VEGA: 13
HGNC: null
Homologene: 74298
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230623
HGNC: null
Homologene: 136292
4933425L06Rik
Name: RIKEN cDNA 4933425L06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 66763
HGNC: null
Homologene: 12028
Nexmif
Name: neurite extension and migration factor
Synonyms: Xpn, C77370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 245555
Homologene: 19589
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cardiac TnT, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21956
Homologene: 68050
Cd55b
Name: CD55 molecule, decay accelerating factor for complement B
Synonyms: Daf-TM, Daf2, complement-transmembrane, TM-DAF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13137
HGNC: HGNC:2665
Homologene: 479
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 78749
Homologene: 37121
Fbxo16
Name: F-box protein 16
Synonyms: Fbx16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 50759
VEGA: 14
Homologene: 9273
Cyb5rl
Name: cytochrome b5 reductase-like
Synonyms: 2810410C14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230582
Homologene: 45506
Olfr61
Name: olfactory receptor 61
Synonyms: GA_x6K02T2PBJ9-42783826-42784758, MOR253-1, IH7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18362
HGNC: null
Homologene: 79374
Actbl2
Name: actin, beta-like 2
Synonyms: 4732495G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 238880
Homologene: 134276
Rgmb
Name: repulsive guidance molecule family member B
Synonyms: RGM domain family, member B, DRAGON, 1110059F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68799
VEGA: 17
Homologene: 65355
Samt3
Name: spermatogenesis associated multipass transmembrane protein 3
Synonyms: 1700072E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 73495
HGNC: null
Homologene: 87060
Gm10604
Name: predicted gene 10604
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: null
VEGA: null
HGNC: null
Homologene: null
Rps2
Name: ribosomal protein S2
Synonyms: Llrep3, Rps2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 16898
Homologene: 37714
Prrt2
Name: proline-rich transmembrane protein 2
Synonyms: 1500031I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 69017
Homologene: 114328
Lysmd1
Name: LysM, putative peptidoglycan-binding, domain containing 1
Synonyms: 2610022K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 217779
Homologene: 41742
Fam229a
Name: family with sequence similarity 229, member A
Synonyms: 1700125D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 68233
Homologene: 47789
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,810,789 bp
  • G to A, chromosome 1 at 37,815,677 bp
  • A to C, chromosome 1 at 77,382,991 bp
  • G to A, chromosome 1 at 82,653,286 bp
  • A to G, chromosome 1 at 86,089,997 bp
  • A to T, chromosome 1 at 130,409,875 bp
  • A to G, chromosome 1 at 134,777,462 bp
  • G to T, chromosome 1 at 135,852,065 bp
  • A to T, chromosome 1 at 135,969,316 bp
  • A to G, chromosome 1 at 139,170,170 bp
  • A to T, chromosome 1 at 150,686,867 bp
  • A to G, chromosome 1 at 159,232,805 bp
  • A to G, chromosome 1 at 171,529,159 bp
  • A to T, chromosome 1 at 182,441,639 bp
  • T to C, chromosome 2 at 31,017,922 bp
  • T to A, chromosome 2 at 69,938,198 bp
  • G to A, chromosome 2 at 80,530,218 bp
  • G to A, chromosome 2 at 82,257,519 bp
  • T to C, chromosome 2 at 82,979,610 bp
  • A to T, chromosome 2 at 85,071,691 bp
  • G to A, chromosome 2 at 101,886,331 bp
  • T to C, chromosome 2 at 152,622,570 bp
  • A to G, chromosome 2 at 165,298,687 bp
  • G to T, chromosome 3 at 31,237,501 bp
  • A to T, chromosome 3 at 50,377,746 bp
  • T to A, chromosome 3 at 86,547,555 bp
  • G to A, chromosome 3 at 95,138,397 bp
  • A to T, chromosome 3 at 108,413,591 bp
  • T to C, chromosome 3 at 123,353,606 bp
  • A to C, chromosome 3 at 135,589,329 bp
  • T to C, chromosome 4 at 11,241,642 bp
  • A to G, chromosome 4 at 11,980,083 bp
  • T to C, chromosome 4 at 48,662,059 bp
  • A to T, chromosome 4 at 58,135,628 bp
  • T to A, chromosome 4 at 65,180,889 bp
  • A to G, chromosome 4 at 107,080,945 bp
  • T to A, chromosome 4 at 114,228,812 bp
  • G to T, chromosome 4 at 117,675,298 bp
  • A to G, chromosome 4 at 129,491,486 bp
  • G to T, chromosome 4 at 141,018,049 bp
  • A to T, chromosome 5 at 20,358,936 bp
  • G to T, chromosome 5 at 20,902,366 bp
  • T to C, chromosome 5 at 63,804,374 bp
  • T to C, chromosome 5 at 74,531,177 bp
  • T to C, chromosome 5 at 87,251,772 bp
  • T to A, chromosome 5 at 87,777,438 bp
  • G to A, chromosome 5 at 110,290,502 bp
  • A to G, chromosome 5 at 110,668,645 bp
  • T to C, chromosome 5 at 121,220,620 bp
  • T to C, chromosome 5 at 121,263,967 bp
  • C to T, chromosome 5 at 123,778,347 bp
  • A to T, chromosome 5 at 127,602,018 bp
  • A to T, chromosome 5 at 127,617,239 bp
  • A to G, chromosome 5 at 147,527,036 bp
  • A to T, chromosome 6 at 40,517,826 bp
  • A to G, chromosome 6 at 123,065,945 bp
  • A to G, chromosome 6 at 148,204,774 bp
  • C to T, chromosome 7 at 19,917,180 bp
  • T to A, chromosome 7 at 99,897,596 bp
  • T to C, chromosome 7 at 112,104,470 bp
  • T to A, chromosome 7 at 116,390,569 bp
  • T to C, chromosome 7 at 127,020,224 bp
  • T to G, chromosome 7 at 128,086,087 bp
  • T to A, chromosome 7 at 134,349,479 bp
  • A to G, chromosome 7 at 139,647,117 bp
  • T to C, chromosome 7 at 140,638,484 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • A to G, chromosome 8 at 91,280,716 bp
  • T to C, chromosome 9 at 82,915,339 bp
  • G to T, chromosome 9 at 100,866,210 bp
  • C to T, chromosome 10 at 81,499,304 bp
  • A to G, chromosome 11 at 40,687,589 bp
  • A to G, chromosome 11 at 43,491,156 bp
  • T to A, chromosome 11 at 72,317,285 bp
  • T to A, chromosome 11 at 99,317,296 bp
  • T to C, chromosome 11 at 102,255,296 bp
  • T to C, chromosome 11 at 105,385,572 bp
  • C to T, chromosome 11 at 111,025,583 bp
  • T to C, chromosome 11 at 113,624,431 bp
  • T to C, chromosome 11 at 120,018,855 bp
  • T to A, chromosome 12 at 30,003,406 bp
  • C to T, chromosome 12 at 40,081,706 bp
  • T to G, chromosome 12 at 81,379,137 bp
  • T to C, chromosome 12 at 98,844,105 bp
  • G to A, chromosome 13 at 46,814,200 bp
  • C to T, chromosome 13 at 60,782,654 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • A to G, chromosome 13 at 73,675,806 bp
  • A to G, chromosome 13 at 92,439,061 bp
  • A to T, chromosome 13 at 102,738,639 bp
  • A to G, chromosome 13 at 105,109,742 bp
  • T to C, chromosome 13 at 111,256,183 bp
  • A to G, chromosome 14 at 31,163,040 bp
  • C to T, chromosome 14 at 33,956,018 bp
  • A to T, chromosome 14 at 45,299,088 bp
  • A to T, chromosome 14 at 65,270,714 bp
  • G to T, chromosome 14 at 118,881,044 bp
  • A to G, chromosome 14 at 122,158,684 bp
  • G to A, chromosome 15 at 8,219,216 bp
  • T to C, chromosome 15 at 44,485,428 bp
  • A to T, chromosome 15 at 82,559,036 bp
  • A to T, chromosome 15 at 84,933,658 bp
  • A to G, chromosome 15 at 96,695,105 bp
  • C to T, chromosome 15 at 101,568,031 bp
  • A to G, chromosome 15 at 101,884,858 bp
  • A to T, chromosome 15 at 102,188,667 bp
  • G to A, chromosome 16 at 20,120,167 bp
  • C to T, chromosome 16 at 34,721,850 bp
  • T to A, chromosome 16 at 37,011,942 bp
  • A to G, chromosome 16 at 37,115,667 bp
  • A to G, chromosome 16 at 57,570,662 bp
  • A to T, chromosome 16 at 57,571,047 bp
  • T to A, chromosome 16 at 63,603,625 bp
  • C to A, chromosome 17 at 15,807,647 bp
  • T to C, chromosome 17 at 21,658,967 bp
  • G to A, chromosome 17 at 24,720,379 bp
  • T to A, chromosome 17 at 31,092,395 bp
  • C to T, chromosome 17 at 35,664,793 bp
  • T to A, chromosome 17 at 63,991,580 bp
  • C to T, chromosome 18 at 4,674,026 bp
  • C to A, chromosome 18 at 12,905,031 bp
  • C to T, chromosome 18 at 58,093,359 bp
  • A to C, chromosome 19 at 12,651,398 bp
  • T to C, chromosome 19 at 17,000,036 bp
  • G to A, chromosome 19 at 25,425,995 bp
  • A to G, chromosome 19 at 37,698,342 bp
  • A to T, chromosome 19 at 46,324,913 bp
  • T to C, chromosome X at 86,046,522 bp
  • T to A, chromosome X at 104,084,393 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2504 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040412-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.