Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2857Btlr/Mmmh
Stock Number:
040447-MU
Citation ID:
RRID:MMRRC_040447-MU
Other Names:
R2857 (G1), C57BL/6J-MtgxR2857Btlr
Major Collection:

Strain Information

Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Fbxo36
Name: F-box protein 36
Synonyms: 0610008D19Rik, 2410002G19Rik, 1110020F21Rik, D1Ertd757e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66153
Homologene: 11927
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Prc1
Name: protein regulator of cytokinesis 1
Synonyms: D7Ertd348e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233406
HGNC: HGNC:9341
Homologene: 37868
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Cuzd1
Name: CUB and zona pellucida-like domains 1
Synonyms: UTCZP, UO-44, ERG-1, Itmap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16433
Homologene: 7389
Riok1
Name: RIO kinase 1
Synonyms: 5430416A05Rik, 3110046C13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71340
VEGA: 13
Homologene: 6950
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Selenow
Name: selenoprotein W
Synonyms: Sepw1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20364
Homologene: 2263
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Amfr
Name: autocrine motility factor receptor
Synonyms: gp78
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23802
HGNC: HGNC:463
Homologene: 888
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Efa6, 1110007H17Rik, Psdl, Efa6a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Garin3
Name: golgi associated RAB2 interactor 3
Synonyms: OTTMUSG00000005491, Fam71b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432552
Homologene: 51067
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434218
Homologene: 128238
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: arachidonate 5 lipoxygenase activating protein, Flap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Trmt11
Name: tRNA methyltransferase 11
Synonyms: 3110045I18Rik, 2410075D05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73681
VEGA: 10
Homologene: 6876
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Or11g27
Name: olfactory receptor family 11 subfamily G member 27
Synonyms: GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, MOR106-14, Olfr265, Olfr743-ps1, Olfr264, Olfr743
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219019
Homologene: 74163
4932425I24Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Stat2
Name: signal transducer and activator of transcription 2
Synonyms: 1600010G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20847
VEGA: 10
Homologene: 3952
Vrk2
Name: vaccinia related kinase 2
Synonyms: 2810003O05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69922
Homologene: 55966
Bpifa6
Name: BPI fold containing family A, member 6
Synonyms: Gm5840
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545477
Homologene: 129594
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: M5, MOR255-2, GA_x6K02T2P1NL-4202012-4201065, Olfr139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259005
Homologene: 77386
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Erich5
Name: glutamate rich 5
Synonyms: BC030476
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239368
VEGA: 15
Homologene: 52129
Zfp326
Name: zinc finger protein 326
Synonyms: ZAN75, 5730470H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54367
Homologene: 10297
Nexn
Name: nexilin
Synonyms: nF actin binding protein, 1110046H09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68810
Homologene: 44892
Mau2
Name: MAU2 sister chromatid cohesion factor
Synonyms: A930019L04Rik, 9130404D08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74549
Homologene: 12574
Ceacam1
Name: CEA cell adhesion molecule 1
Synonyms: CD66a, MHVR1, mmCGM1, mCEA1, mmCGM2, Hv-2, Bgp, Mhv-1, Cea-7, Cea-1, Cea1, Bgp1, C-CAM, Hv2, Cea7, Cc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26365
HGNC: HGNC:1814
Homologene: 128630
Fibin
Name: fin bud initiation factor homolog (zebrafish)
Synonyms: Fibin, 1110018M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67606
Homologene: 12163
Ehd2
Name: EH-domain containing 2
Synonyms: C130052H20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259300
HGNC: HGNC:3243
Homologene: 22825
Or9e1
Name: olfactory receptor family 9 subfamily E member 1
Synonyms: GA_x6K02T2NKPP-565870-564944, MOR222-1, Olfr311
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258530
Homologene: 77375
Slco1a7
Name: solute carrier organic anion transporter family, member 1a7
Synonyms: Gm5724
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435927
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Sycp3
Name: synaptonemal complex protein 3
Synonyms: Scp3, Cor1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20962
Homologene: 7964
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
C330018D20Rik
Name: RIKEN cDNA C330018D20 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77422
Homologene: 35412
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 84,896,595 bp
  • A to C, chromosome 2 at 22,673,975 bp
  • A to G, chromosome 2 at 104,778,268 bp
  • C to T, chromosome 2 at 110,362,197 bp
  • G to A, chromosome 2 at 153,989,274 bp
  • C to A, chromosome 3 at 88,107,596 bp
  • C to T, chromosome 3 at 152,248,043 bp
  • G to A, chromosome 4 at 118,369,402 bp
  • A to T, chromosome 5 at 101,875,930 bp
  • G to A, chromosome 5 at 105,888,529 bp
  • A to T, chromosome 5 at 125,300,331 bp
  • T to C, chromosome 5 at 149,285,439 bp
  • A to G, chromosome 6 at 141,744,538 bp
  • A to G, chromosome 7 at 15,919,960 bp
  • A to T, chromosome 7 at 15,964,129 bp
  • T to A, chromosome 7 at 25,474,017 bp
  • T to A, chromosome 7 at 48,198,336 bp
  • A to G, chromosome 7 at 80,312,221 bp
  • A to T, chromosome 7 at 104,336,232 bp
  • C to T, chromosome 7 at 131,316,134 bp
  • T to A, chromosome 7 at 141,259,680 bp
  • T to C, chromosome 8 at 70,019,824 bp
  • A to T, chromosome 8 at 94,005,214 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to T, chromosome 9 at 111,366,933 bp
  • G to C, chromosome 10 at 30,547,748 bp
  • C to T, chromosome 10 at 60,382,653 bp
  • T to A, chromosome 10 at 79,381,256 bp
  • A to G, chromosome 10 at 88,467,372 bp
  • C to T, chromosome 10 at 93,045,282 bp
  • A to G, chromosome 10 at 128,276,901 bp
  • C to A, chromosome 11 at 26,483,324 bp
  • T to C, chromosome 11 at 46,405,212 bp
  • T to A, chromosome 11 at 58,841,882 bp
  • C to T, chromosome 11 at 74,044,827 bp
  • T to C, chromosome 12 at 76,288,925 bp
  • T to C, chromosome 13 at 38,049,077 bp
  • T to A, chromosome 14 at 50,533,440 bp
  • C to T, chromosome 15 at 34,471,414 bp
  • C to T, chromosome 16 at 22,805,551 bp
  • A to C, chromosome 16 at 38,302,713 bp
  • A to G, chromosome 17 at 52,977,933 bp
  • A to G, chromosome 18 at 56,962,459 bp
  • A to T, chromosome 19 at 16,766,552 bp
  • G to C, chromosome 19 at 46,324,420 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2857 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040447-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.