Strain Name:
C57BL/6J-MtgxR4154Btlr/Mmmh
Stock Number:
040998-MU
Citation ID:
RRID:MMRRC_040998-MU
Other Names:
R4154 (G1), C57BL/6J-MtgxR4154Btlr
Major Collection:

Gene Information

Gsc2
Name: goosecoid homebox 2
Synonyms: 4930568H22Rik, Gscl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 195333
HGNC: HGNC:4613
Homologene: 3884
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Tubgcp5
Name: tubulin, gamma complex associated protein 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233276
Homologene: 14172
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, HBLP1, AD3, GRAM domain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 54610
Homologene: 31421
Pik3c3
Name: phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms: Vps34, 5330434F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225326
HGNC: HGNC:8974
Homologene: 1986
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Fas
Name: Fas (TNF receptor superfamily member 6)
Synonyms: CD95, APO-1, TNFR6, Tnfrsf6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14102
VEGA: 19
Homologene: 27
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67772
Homologene: 72405
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56030
Homologene: 32428
Crim1
Name: cysteine rich transmembrane BMP regulator 1 (chordin like)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 50766
VEGA: 17
HGNC: HGNC:2359
Homologene: 9510
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 672125
Homologene: 129606
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14696
Homologene: 69140
Ctsc
Name: cathepsin C
Synonyms: DPP1, dipeptidylpeptidase 1, DPPI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Thoc6
Name: THO complex 6
Synonyms: F830014G06Rik, Wdr58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 386612
Homologene: 11533
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Tcp-2, Pgk-2, Tcp-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21949
Homologene: 950
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627537
Homologene: 129750
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71096
Homologene: 56834
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Gjd4
Name: gap junction protein, delta 4
Synonyms: connexin 39, Cx39, 9430022F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320277
Homologene: 23371
Zc3h15
Name: zinc finger CCCH-type containing 15
Synonyms: FM22, Ierepo4, 1810012H02Rik, 1700006A17Rik, 2610312B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69082
Homologene: 10216
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Olfr690
Name: olfactory receptor 690
Synonyms: GA_x6K02T2PBJ9-7959171-7958224, MOR31-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56860
Homologene: 10653
Lum
Name: lumican
Synonyms: Ldc, SLRR2D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17022
VEGA: 10
HGNC: HGNC:6724
Homologene: 37614
Clvs1
Name: clavesin 1
Synonyms: 4933402J24Rik, Rlbp1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74438
Homologene: 65267
Vat1l
Name: vesicle amine transport protein 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270097
Homologene: 10855
AI593442
Name: expressed sequence AI593442
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330941
VEGA: 9
Homologene: 52281
Cptp
Name: ceramide-1-phosphate transfer protein
Synonyms: Gltpd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 79554
Homologene: 11550
Vegfb
Name: vascular endothelial growth factor B
Synonyms: VEGF-B, Vrf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22340
Homologene: 87131
Igkv12-44
Name: immunoglobulin kappa variable 12-44
Synonyms: Gm16851
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545851
Ighv1-72
Name: immunoglobulin heavy variable 1-72
Synonyms: Gm16709
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 619916
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 8,583,345 bp
  • T to C, chromosome 1 at 36,808,793 bp
  • C to T, chromosome 1 at 39,386,135 bp
  • T to G, chromosome 2 at 57,998,493 bp
  • A to C, chromosome 2 at 82,987,069 bp
  • T to C, chromosome 2 at 83,658,569 bp
  • A to T, chromosome 2 at 181,995,079 bp
  • A to G, chromosome 3 at 32,589,811 bp
  • T to C, chromosome 3 at 123,672,227 bp
  • T to C, chromosome 4 at 9,282,004 bp
  • C to T, chromosome 4 at 9,639,250 bp
  • A to G, chromosome 4 at 32,707,475 bp
  • A to G, chromosome 4 at 58,069,068 bp
  • A to G, chromosome 4 at 63,834,358 bp
  • T to C, chromosome 4 at 123,471,813 bp
  • A to G, chromosome 4 at 155,867,200 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to T, chromosome 6 at 69,814,655 bp
  • T to C, chromosome 7 at 7,294,834 bp
  • G to A, chromosome 7 at 55,805,329 bp
  • G to A, chromosome 7 at 88,299,547 bp
  • T to C, chromosome 7 at 105,329,385 bp
  • A to G, chromosome 7 at 116,527,667 bp
  • G to C, chromosome 8 at 114,205,803 bp
  • G to T, chromosome 8 at 127,474,396 bp
  • A to T, chromosome 9 at 52,677,904 bp
  • T to C, chromosome 10 at 97,568,953 bp
  • G to A, chromosome 11 at 49,835,778 bp
  • C to T, chromosome 12 at 51,627,131 bp
  • G to C, chromosome 12 at 82,425,214 bp
  • A to T, chromosome 12 at 115,758,397 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • A to G, chromosome 13 at 59,642,353 bp
  • T to C, chromosome 14 at 52,207,211 bp
  • T to C, chromosome 15 at 9,626,021 bp
  • A to G, chromosome 15 at 89,159,642 bp
  • TGCAGCAGCAGCAGCAG to TGCAGCAGCAGCAG, chromosome 16 at 17,914,802 bp
  • AAAACAGGAGTATTGATTGGAAAC to AAAAC, chromosome 17 at 19,523,419 bp
  • A to G, chromosome 17 at 23,666,092 bp
  • A to G, chromosome 17 at 40,208,258 bp
  • A to G, chromosome 17 at 78,237,843 bp
  • G to T, chromosome 18 at 9,280,811 bp
  • G to A, chromosome 18 at 30,311,283 bp
  • A to G, chromosome 18 at 36,953,586 bp
  • T to C, chromosome 19 at 6,986,078 bp
  • T to G, chromosome 19 at 34,318,828 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
(Deceased) Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4154 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040998-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.