Strain Name:
C57BL/6J-MtgxR4154Btlr/Mmmh
Stock Number:
040998-MU
Citation ID:
RRID:MMRRC_040998-MU
Other Names:
R4154 (G1), C57BL/6J-MtgxR4154Btlr
Major Collection:

Strain Information

Gsc2
Name: goosecoid homebox 2
Synonyms: Gscl, 4930568H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 195333
HGNC: HGNC:4613
Homologene: 3884
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, trabeculin alpha, Acf7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Shroom3
Name: shroom family member 3
Synonyms: Shrm3, D5Ertd287e, Shrm
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, PAR-3, D8Ertd580e, Pard3a, Par3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, GRAM domain, HBLP1, AD3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Pik3c3
Name: phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms: 5330434F23Rik, Vps34
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225326
HGNC: HGNC:8974
Homologene: 1986
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, LOC213784, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Fas
Name: Fas cell surface death receptor
Synonyms: Tnfrsf6, APO-1, TNFR6, CD95
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14102
VEGA: 19
Homologene: 27
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: Duplin, 5830451P18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, YR-23, D1Bwg0491e, Rw1, Neg, 2610524E03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Crim1
Name: cysteine rich transmembrane BMP regulator 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50766
VEGA: 17
HGNC: HGNC:2359
Homologene: 9510
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14696
Homologene: 69140
Ctsc
Name: cathepsin C
Synonyms: dipeptidylpeptidase 1, DPP1, DPPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Asph
Name: aspartate-beta-hydroxylase
Synonyms: aspartyl beta-hydroxylase, calsequestrin-binding protein, BAH, jumbug, 3110001L23Rik, junctate, cI-37, Junctin, 2310005F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Golm1
Name: golgi membrane protein 1
Synonyms: Golph2, GP73, PSEC0257, D030064E01Rik, 2310001L02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Thoc6
Name: THO complex 6
Synonyms: Wdr58, F830014G06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386612
Homologene: 11533
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Pgk-2, Tcp-2, Tcp-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD30LG, CD153
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21949
Homologene: 950
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Gjd4
Name: gap junction protein, delta 4
Synonyms: Cx39, connexin 39, 9430022F06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Zc3h15
Name: zinc finger CCCH-type containing 15
Synonyms: FM22, 2610312B22Rik, 1700006A17Rik, Ierepo4, 1810012H02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69082
Homologene: 10216
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clcn4-2, Clc4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Or52b1
Name: olfactory receptor family 52 subfamily B member 1
Synonyms: Olfr690, MOR31-2, GA_x6K02T2PBJ9-7959171-7958224
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56860
Homologene: 10653
Lum
Name: lumican
Synonyms: Ldc, SLRR2D
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17022
VEGA: 10
HGNC: HGNC:6724
Homologene: 37614
Clvs1
Name: clavesin 1
Synonyms: Rlbp1l1, 4933402J24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74438
Homologene: 65267
Vat1l
Name: vesicle amine transport protein 1 like
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270097
Homologene: 10855
AI593442
Name: expressed sequence AI593442
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330941
VEGA: 9
Homologene: 52281
Cptp
Name: ceramide-1-phosphate transfer protein
Synonyms: Gltpd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 79554
Homologene: 11550
Vegfb
Name: vascular endothelial growth factor B
Synonyms: VEGF-B, Vrf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22340
Homologene: 87131
Igkv12-44
Name: immunoglobulin kappa variable 12-44
Synonyms: Gm16851
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545851
Pcdha4
Name: protocadherin alpha 4
Synonyms: Crnr1, Cnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 8,583,345 bp
  • T to C, chromosome 1 at 36,808,793 bp
  • C to T, chromosome 1 at 39,386,135 bp
  • T to G, chromosome 2 at 57,998,493 bp
  • A to C, chromosome 2 at 82,987,069 bp
  • T to C, chromosome 2 at 83,658,569 bp
  • A to T, chromosome 2 at 181,995,079 bp
  • A to G, chromosome 3 at 32,589,811 bp
  • T to C, chromosome 3 at 123,672,227 bp
  • T to C, chromosome 4 at 9,282,004 bp
  • C to T, chromosome 4 at 9,639,250 bp
  • A to G, chromosome 4 at 32,707,475 bp
  • A to G, chromosome 4 at 58,069,068 bp
  • A to G, chromosome 4 at 63,834,358 bp
  • T to C, chromosome 4 at 123,471,813 bp
  • A to G, chromosome 4 at 155,867,200 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to T, chromosome 6 at 69,814,655 bp
  • T to C, chromosome 7 at 7,294,834 bp
  • G to A, chromosome 7 at 55,805,329 bp
  • G to A, chromosome 7 at 88,299,547 bp
  • T to C, chromosome 7 at 105,329,385 bp
  • A to G, chromosome 7 at 116,527,667 bp
  • G to C, chromosome 8 at 114,205,803 bp
  • G to T, chromosome 8 at 127,474,396 bp
  • A to T, chromosome 9 at 52,677,904 bp
  • T to C, chromosome 10 at 97,568,953 bp
  • G to A, chromosome 11 at 49,835,778 bp
  • C to T, chromosome 12 at 51,627,131 bp
  • G to C, chromosome 12 at 82,425,214 bp
  • A to T, chromosome 12 at 115,758,397 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • A to G, chromosome 13 at 59,642,353 bp
  • T to C, chromosome 14 at 52,207,211 bp
  • T to C, chromosome 15 at 9,626,021 bp
  • A to G, chromosome 15 at 89,159,642 bp
  • TGCAGCAGCAGCAGCAG to TGCAGCAGCAGCAG, chromosome 16 at 17,914,802 bp
  • AAAACAGGAGTATTGATTGGAAAC to AAAAC, chromosome 17 at 19,523,419 bp
  • A to G, chromosome 17 at 23,666,092 bp
  • A to G, chromosome 17 at 40,208,258 bp
  • A to G, chromosome 17 at 78,237,843 bp
  • G to T, chromosome 18 at 9,280,811 bp
  • G to A, chromosome 18 at 30,311,283 bp
  • A to G, chromosome 18 at 36,953,586 bp
  • T to C, chromosome 19 at 6,986,078 bp
  • T to G, chromosome 19 at 34,318,828 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4154 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040998-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.