Strain Name:
C57BL/6J-MtgxR4295Btlr/Mmmh
Stock Number:
041084-MU
Citation ID:
RRID:MMRRC_041084-MU
Other Names:
R4295 (G1), C57BL/6J-MtgxR4295Btlr
Major Collection:

Strain Information

Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 2500002E12Rik, 1100001C18Rik, A330076K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Phf14
Name: PHD finger protein 14
Synonyms: 5730446A07Rik, 1110001C23Rik, 4932409F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Pigf
Name: phosphatidylinositol glycan anchor biosynthesis, class F
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18701
HGNC: HGNC:8962
Homologene: 31103
Mapkapk3
Name: mitogen-activated protein kinase-activated protein kinase 3
Synonyms: MK3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102626
HGNC: HGNC:6888
Homologene: 55836
Foxj3
Name: forkhead box J3
Synonyms: Fhd6, C330039G02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230700
Homologene: 35243
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Kif18a
Name: kinesin family member 18A
Synonyms: gcd2, N-8 kinesin, B130001M12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, npht, Lams
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224171
Homologene: 10842
4833420G17Rik
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Pcgf2
Name: polycomb group ring finger 2
Synonyms: Rnf110, mel-18, Zfp144, Mel18
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22658
Homologene: 5174
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21872
Homologene: 2445
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Cugbp2, Napor-2, ETR-3, B230345P09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67996
Homologene: 110783
Arid3b
Name: AT-rich interaction domain 3B
Synonyms: Bdp, Dri2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56380
Homologene: 4721
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Prdm10
Name: PR domain containing 10
Synonyms: tristanin, LOC382066
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382066
Homologene: 45718
Dlg3
Name: discs large MAGUK scaffold protein 3
Synonyms: Dlgh3, DLG3, SAP102
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 53310
HGNC: HGNC:2902
Homologene: 41157
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Fhdc1
Name: FH2 domain containing 1
Synonyms: 6330505N24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229474
Homologene: 18920
Ush2a
Name: usherin
Synonyms: LOC381317, MUSH2A, A930011D15Rik, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: Dnahcl1, Dnahc17, LOC382552, 2810003K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Plpp4
Name: phospholipid phosphatase 4
Synonyms: LOC381925, C030048B12Rik, Ppapdc1a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381925
Homologene: 38751
Unc13c
Name: unc-13 homolog C
Synonyms: Unc13h3, 1500037O19Rik, Munc13-3, D9Ertd414e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Slc22a21
Name: solute carrier family 22 (organic cation transporter), member 21
Synonyms: Octn3, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56517
Homologene: 137336
Vmn1r76
Name: vomeronasal 1 receptor 76
Synonyms: V1rg4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171239
Pcdhb5
Name: protocadherin beta 5
Synonyms: Pcdhb4A, PcdhbE
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93876
HGNC: HGNC:8689
Homologene: 75103
Dpy19l1
Name: dpy-19 like C-mannosyltransferase 1
Synonyms: 1100001I19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244745
Homologene: 14762
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: Hisppd2a, B430315C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Or14c46
Name: olfactory receptor family 14 subfamily C member 46
Synonyms: MOR227-6P, Olfr310, GA_x6K02T2NHDJ-9838699-9839697
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258222
Homologene: 128066
Or5m3
Name: olfactory receptor family 5 subfamily M member 3
Synonyms: GA_x6K02T2Q125-47485813-47486745, MOR199-1, Olfr1032
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258572
Homologene: 17299
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216188
Homologene: 51942
Gm4841
Name: predicted gene 4841
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225594
VEGA: 18
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Or2v2
Name: olfactory receptor family 2 subfamily V member 2
Synonyms: MOR276-2, GA_x6K02T2QP88-6321048-6321995, Olfr1396
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258334
Homologene: 28537
Ttll11
Name: tubulin tyrosine ligase-like family, member 11
Synonyms: 4932702F08Rik, D2Ertd624e, 4933424A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74410
Homologene: 77534
Or8d2b
Name: olfactory receptor family 8 subfamily D member 2D
Synonyms: Olfr926, GA_x6K02T2PVTD-32573036-32573962, MOR171-8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258811
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Angel1
Name: angel homolog 1
Synonyms: 1110030H02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68737
Homologene: 32251
Stk32c
Name: serine/threonine kinase 32C
Synonyms: Pkek, YANK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57740
Homologene: 75157
Fam98a
Name: family with sequence similarity 98, member A
Synonyms: 2810405J04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72722
Homologene: 41042
Or9a4
Name: olfactory receptor family 9 subfamily A member 4
Synonyms: MOR120-2, Olfr460, GA_x6K02T2P3E9-6947292-6946348
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258381
Homologene: 64866
Vmn1r192
Name: vomeronasal 1 receptor 192
Synonyms: V1ri1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252907
Homologene: 110880
Cd200r4
Name: CD200 receptor 4
Synonyms: MCD200RLa, F630107N04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239849
Homologene: 45557
Gm6124
Name: predicted gene 6124
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 620018
Homologene: 45597
4933427D06Rik
Name: RIKEN cDNA 4933427D06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232217
Homologene: 87249
Xndc1
Name: Xrcc1 N-terminal domain containing 1
Synonyms: Xndr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102443350
Homologene: 128476
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,777,755 bp
  • C to T, chromosome 1 at 181,820,702 bp
  • C to T, chromosome 1 at 188,576,251 bp
  • T to C, chromosome 2 at 6,604,064 bp
  • G to A, chromosome 2 at 25,778,099 bp
  • TCGCCGCCGCCGCCGCCGCCGC to TCGCCGCCGCCGCCGCCGC, chromosome 2 at 35,979,552 bp
  • T to C, chromosome 2 at 86,008,270 bp
  • T to C, chromosome 2 at 109,293,053 bp
  • T to G, chromosome 2 at 121,342,644 bp
  • T to C, chromosome 2 at 162,934,716 bp
  • C to A, chromosome 3 at 84,444,826 bp
  • G to T, chromosome 4 at 119,626,297 bp
  • C to T, chromosome 6 at 11,987,097 bp
  • T to A, chromosome 6 at 40,572,156 bp
  • A to G, chromosome 6 at 89,107,901 bp
  • T to C, chromosome 7 at 11,931,130 bp
  • A to G, chromosome 7 at 26,562,590 bp
  • A to T, chromosome 7 at 39,222,771 bp
  • T to C, chromosome 7 at 65,323,150 bp
  • A to T, chromosome 7 at 86,269,760 bp
  • T to A, chromosome 7 at 102,081,487 bp
  • A to G, chromosome 7 at 129,307,632 bp
  • T to C, chromosome 7 at 139,120,788 bp
  • G to A, chromosome 9 at 24,414,354 bp
  • A to G, chromosome 9 at 31,316,294 bp
  • A to G, chromosome 9 at 38,877,313 bp
  • A to T, chromosome 9 at 57,790,430 bp
  • A to G, chromosome 9 at 73,734,504 bp
  • A to G, chromosome 9 at 95,874,426 bp
  • T to C, chromosome 9 at 107,258,932 bp
  • A to G, chromosome 9 at 108,486,211 bp
  • A to G, chromosome 10 at 8,730,242 bp
  • C to T, chromosome 10 at 83,495,920 bp
  • G to T, chromosome 10 at 88,754,519 bp
  • T to A, chromosome 11 at 49,113,427 bp
  • T to C, chromosome 11 at 53,969,503 bp
  • A to T, chromosome 11 at 97,693,456 bp
  • A to T, chromosome 11 at 118,118,772 bp
  • A to G, chromosome 12 at 86,720,283 bp
  • T to A, chromosome 13 at 22,187,295 bp
  • T to C, chromosome 13 at 119,469,713 bp
  • T to A, chromosome 14 at 60,709,555 bp
  • G to A, chromosome 15 at 45,114,444 bp
  • T to C, chromosome 16 at 44,832,876 bp
  • T to A, chromosome 16 at 49,013,249 bp
  • A to T, chromosome 17 at 75,541,347 bp
  • A to G, chromosome 17 at 87,023,756 bp
  • T to A, chromosome 18 at 37,322,681 bp
  • T to C, chromosome 18 at 60,270,190 bp
  • A to T, chromosome X at 100,796,682 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4295 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041084-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.