Strain Name:
Stock Number:
Citation ID:
Other Names:
R4498 (G1), C57BL/6J-MtgxR4498Btlr
Major Collection:

Gene Information

Gene Symbol: Mthfd1 [MGI:1342005] (Mus musculus (mouse))
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: DCS, Mthfd, E430024A07Rik
Chromosome: 12
Alteration at locus: Chemically Induced
Gene Symbol: Nup155 [MGI:2181182] (Mus musculus (mouse))
Name: nucleoporin 155
Synonyms: D930027M19Rik
Chromosome: 15
Alteration at locus: Chemically Induced
Gene Symbol: Aco2 [MGI:87880] (Mus musculus (mouse))
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e
Chromosome: 15
Alteration at locus: Chemically Induced
Gene Symbol: Arhgap12 [MGI:1922665] (Mus musculus (mouse))
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Chromosome: 18
Alteration at locus: Chemically Induced
Gene Symbol: Prr12 [MGI:2679002] (Mus musculus (mouse))
Name: proline rich 12
Chromosome: 7
Alteration at locus: Chemically Induced
Gene Symbol: Cux1 [MGI:88568] (Mus musculus (mouse))
Name: cut-like homeobox 1
Synonyms: Cux-1, Cutl1, Cux, CDP
Chromosome: 5
Alteration at locus: Chemically Induced
Gene Symbol: Med27 [MGI:1916225] (Mus musculus (mouse))
Name: mediator complex subunit 27
Synonyms: D2Ertd434e, Crsp8, 2310042P07Rik, 1500015J03Rik
Chromosome: 2
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,741,780 bp
  • G to T, chromosome 1 at 153,907,103 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • T to C, chromosome 2 at 29,471,342 bp
  • T to C, chromosome 2 at 50,280,224 bp
  • T to C, chromosome 2 at 101,684,546 bp
  • A to G, chromosome 2 at 155,813,988 bp
  • C to T, chromosome 2 at 172,557,182 bp
  • A to G, chromosome 3 at 125,438,358 bp
  • C to A, chromosome 3 at 127,586,100 bp
  • A to T, chromosome 4 at 88,628,892 bp
  • G to T, chromosome 4 at 116,597,241 bp
  • G to A, chromosome 4 at 126,129,751 bp
  • T to C, chromosome 4 at 152,287,085 bp
  • T to C, chromosome 5 at 136,312,993 bp
  • T to A, chromosome 6 at 122,082,752 bp
  • T to A, chromosome 7 at 14,581,049 bp
  • T to A, chromosome 7 at 43,352,276 bp
  • T to C, chromosome 7 at 45,045,914 bp
  • T to A, chromosome 7 at 72,183,851 bp
  • A to G, chromosome 7 at 109,921,383 bp
  • T to A, chromosome 8 at 10,435,869 bp
  • T to C, chromosome 8 at 13,455,998 bp
  • T to C, chromosome 8 at 13,614,587 bp
  • G to C, chromosome 9 at 20,027,733 bp
  • A to G, chromosome 9 at 49,472,405 bp
  • G to A, chromosome 9 at 119,958,819 bp
  • A to G, chromosome 10 at 5,031,768 bp
  • T to C, chromosome 11 at 55,270,097 bp
  • T to C, chromosome 11 at 67,251,752 bp
  • T to C, chromosome 11 at 67,815,880 bp
  • T to C, chromosome 11 at 99,543,074 bp
  • C to A, chromosome 11 at 103,501,798 bp
  • G to T, chromosome 12 at 76,314,990 bp
  • G to A, chromosome 12 at 102,369,680 bp
  • T to C, chromosome 12 at 103,654,067 bp
  • C to T, chromosome 14 at 47,096,109 bp
  • C to T, chromosome 14 at 101,608,336 bp
  • A to G, chromosome 15 at 8,153,673 bp
  • A to C, chromosome 15 at 30,619,874 bp
  • G to A, chromosome 15 at 81,895,285 bp
  • C to T, chromosome 16 at 18,623,392 bp
  • T to A, chromosome 17 at 14,945,115 bp
  • A to T, chromosome 17 at 33,334,703 bp
  • A to T, chromosome 17 at 35,439,530 bp
  • T to C, chromosome 17 at 46,510,941 bp
  • ATTAGGGGATGGTCTTAGGG to ATTAGGG, chromosome 17 at 46,725,736 bp
  • A to T, chromosome 18 at 6,111,774 bp
  • T to A, chromosome 18 at 25,110,239 bp
  • A to G, chromosome 18 at 32,014,229 bp
  • T to C, chromosome 19 at 12,862,669 bp
  • T to A, chromosome X at 155,264,068 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041751-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.