Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4498Btlr/Mmmh
Stock Number:
041751-MU
Citation ID:
RRID:MMRRC_041751-MU
Other Names:
R4498 (G1), C57BL/6J-MtgxR4498Btlr
Major Collection:

Strain Information

Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Arhgap12
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75415
Homologene: 23089
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Med27
Name: mediator complex subunit 27
Synonyms: 1500015J03Rik, 2310042P07Rik, D2Ertd434e, Crsp8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68975
HGNC: HGNC:2377
Homologene: 3152
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Mff
Name: mitochondrial fission factor
Synonyms: 5230400G24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75734
Homologene: 87000
Tfap2c
Name: transcription factor AP-2, gamma
Synonyms: Ap-2.2, Stra2, AP2gamma, Tcfap2c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21420
Homologene: 2423
Mmadhc
Name: methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms: 2010311D03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109129
Homologene: 9248
Rasa3
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Glul
Name: glutamate-ammonia ligase
Synonyms: Glns, GS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14645
HGNC: HGNC:4341
Homologene: 37567
Zfp81
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224694
Homologene: 138633
Stk40
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74178
Homologene: 12542
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Siglecf
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233186
Homologene: 50482
Phf10
Name: PHD finger protein 10
Synonyms: 1810055P05Rik, Baf45a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72057
Homologene: 10112
Septin5
Name: septin 5
Synonyms: Cdcrel1, Pnutl1, Sept5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18951
VEGA: 16
HGNC: HGNC:9164
Homologene: 74446
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, Catnd2, neurojugin, catenin (cadherin associated protein), delta 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Samd4
Name: sterile alpha motif domain containing 4
Synonyms: 4933436G17Rik, 1700111L17Rik, 1700024G08Rik, Smaug, sunk
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74480
Homologene: 19167
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Traf6
Name: TNF receptor-associated factor 6
Synonyms: 2310003F17Rik, C630032O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22034
Homologene: 3395
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Serpina6
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12401
HGNC: HGNC:1540
Homologene: 20417
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Or5b21
Name: olfactory receptor family 5 subfamily B member 21
Synonyms: GA_x6K02T2RE5P-3191201-3192160, MOR202-4, Olfr1444
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258697
Homologene: 64906
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Gnmt
Name: glycine N-methyltransferase
Synonyms: glycine N methyl transferase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14711
HGNC: HGNC:4415
Homologene: 7741
Mmp24
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17391
HGNC: HGNC:7172
Homologene: 21331
Ccdc17
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622665
Homologene: 77410
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Qa-7, Qa7, Ped
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15018
Homologene: 128352
Spopl
Name: speckle-type BTB/POZ protein-like
Synonyms: E430033K04Rik, 4921517N04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76857
Homologene: 78016
Or7e173
Name: olfactory receptor family 7 subfamily E member 173
Synonyms: GA_x6K02T2PVTD-13768406-13767468, MOR145-5, Olfr866
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258551
HGNC: HGNC:8396
Homologene: 133687
Ttc12
Name: tetratricopeptide repeat domain 12
Synonyms: E330017O07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235330
Homologene: 32375
Dhrs7c
Name: dehydrogenase/reductase 7C
Synonyms: 1110001P11Rik, dehydrogenase/reductase (SDR family) member 7C
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68460
Homologene: 19108
Tmem255b
Name: transmembrane protein 255B
Synonyms: LOC272465, Fam70b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272465
Homologene: 18804
Acot9
Name: acyl-CoA thioesterase 9
Synonyms: p48, MT-ACT48, U8, 0610041P13Rik, Acate2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 56360
Homologene: 8206
Nlrp5-ps
Name: NLR family, pyrin domain containing 5, pseudogene
Synonyms: Gm18756
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100417675
Hes3
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15207
Homologene: 7358
Gm25694
Name: predicted gene, 25694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,741,780 bp
  • G to T, chromosome 1 at 153,907,103 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • T to C, chromosome 2 at 29,471,342 bp
  • T to C, chromosome 2 at 50,280,224 bp
  • T to C, chromosome 2 at 101,684,546 bp
  • A to G, chromosome 2 at 155,813,988 bp
  • C to T, chromosome 2 at 172,557,182 bp
  • A to G, chromosome 3 at 125,438,358 bp
  • C to A, chromosome 3 at 127,586,100 bp
  • A to T, chromosome 4 at 88,628,892 bp
  • G to T, chromosome 4 at 116,597,241 bp
  • G to A, chromosome 4 at 126,129,751 bp
  • T to C, chromosome 4 at 152,287,085 bp
  • T to C, chromosome 5 at 136,312,993 bp
  • T to A, chromosome 6 at 122,082,752 bp
  • T to A, chromosome 7 at 14,581,049 bp
  • T to A, chromosome 7 at 43,352,276 bp
  • T to C, chromosome 7 at 45,045,914 bp
  • T to A, chromosome 7 at 72,183,851 bp
  • A to G, chromosome 7 at 109,921,383 bp
  • T to A, chromosome 8 at 10,435,869 bp
  • T to C, chromosome 8 at 13,455,998 bp
  • T to C, chromosome 8 at 13,614,587 bp
  • G to C, chromosome 9 at 20,027,733 bp
  • A to G, chromosome 9 at 49,472,405 bp
  • G to A, chromosome 9 at 119,958,819 bp
  • A to G, chromosome 10 at 5,031,768 bp
  • T to C, chromosome 11 at 55,270,097 bp
  • T to C, chromosome 11 at 67,251,752 bp
  • T to C, chromosome 11 at 67,815,880 bp
  • T to C, chromosome 11 at 99,543,074 bp
  • C to A, chromosome 11 at 103,501,798 bp
  • G to T, chromosome 12 at 76,314,990 bp
  • G to A, chromosome 12 at 102,369,680 bp
  • T to C, chromosome 12 at 103,654,067 bp
  • C to T, chromosome 14 at 47,096,109 bp
  • C to T, chromosome 14 at 101,608,336 bp
  • A to G, chromosome 15 at 8,153,673 bp
  • A to C, chromosome 15 at 30,619,874 bp
  • G to A, chromosome 15 at 81,895,285 bp
  • C to T, chromosome 16 at 18,623,392 bp
  • T to A, chromosome 17 at 14,945,115 bp
  • A to T, chromosome 17 at 33,334,703 bp
  • A to T, chromosome 17 at 35,439,530 bp
  • T to C, chromosome 17 at 46,510,941 bp
  • ATTAGGGGATGGTCTTAGGG to ATTAGGG, chromosome 17 at 46,725,736 bp
  • A to T, chromosome 18 at 6,111,774 bp
  • T to A, chromosome 18 at 25,110,239 bp
  • A to G, chromosome 18 at 32,014,229 bp
  • T to C, chromosome 19 at 12,862,669 bp
  • T to A, chromosome X at 155,264,068 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041751-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.