Strain Name:
Stock Number:
Citation ID:
Other Names:
R4498 (G1), C57BL/6J-MtgxR4498Btlr
Major Collection:

Gene Information

Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: E430024A07Rik, Mthfd, DCS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 108156
VEGA: 12
Homologene: 55940
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 170762
VEGA: 15
Homologene: 43155
Name: aconitase 2, mitochondrial
Synonyms: Aco3, D10Wsu183e, Aco-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 11429
Homologene: 856
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 75415
Homologene: 23089
Name: proline rich 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233210
Homologene: 18957
Name: cut-like homeobox 1
Synonyms: Cux-1, Cux, Cutl1, CDP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 13047
Name: mediator complex subunit 27
Synonyms: Crsp8, 1500015J03Rik, 2310042P07Rik, D2Ertd434e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68975
Homologene: 3152
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 71643
Homologene: 34708
Name: mitochondrial fission factor
Synonyms: 5230400G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 75734
Homologene: 87000
Name: transcription factor AP-2, gamma
Synonyms: Tcfap2c, AP2gamma, Stra2, Ap-2.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 21420
Homologene: 2423
Name: methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms: 2010311D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 109129
Homologene: 9248
Name: RAS p21 protein activator 3
Synonyms: R-Ras gap, GAPIII activator 3, hlb381, GAPIII, Ras GTPase-activating protein III, scat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 19414
Homologene: 7217
Name: glutamate-ammonia ligase (glutamine synthetase)
Synonyms: Glns, GS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14645
Homologene: 37567
Name: zinc finger protein 81
Synonyms: C330034P10Rik, Zfp78, D330034E10Rik, KRAB13, Hszfp36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224694
Homologene: 138633
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 74178
Homologene: 12542
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244049
Homologene: 69254
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233186
Homologene: 50482
Name: PHD finger protein 10
Synonyms: 1810055P05Rik, Baf45a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 72057
Homologene: 10112
Name: septin 5
Synonyms: Cdcrel1, Pnutl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 18951
VEGA: 16
Homologene: 74446
Name: catenin (cadherin associated protein), delta 2
Synonyms: Catnd2, Nprap, neurojugin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18163
VEGA: 15
Homologene: 55574
Name: sterile alpha motif domain containing 4
Synonyms: 1700024G08Rik, Smaug, 4933436G17Rik, sunk, 1700111L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 74480
Homologene: 19167
Name: expressed sequence C87499
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381590
Name: myosin XVI
Synonyms: BM140241, C230040D10Rik, Nyap3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244281
Homologene: 34710
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237954
Homologene: 138824
Name: FAT atypical cadherin 2
Synonyms: Fath2, mKIAA0811, LOC245827, EMI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 245827
Homologene: 1110
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 64580
Homologene: 11208
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78309
Homologene: 56696
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 17922
Homologene: 81947
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74052
Homologene: 14728
Name: DENN/MADD domain containing 5A
Synonyms: ORF37, Rab6ip1, 1500012B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19347
Homologene: 14584
Name: TNF receptor-associated factor 6
Synonyms: C630032O20Rik, 2310003F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22034
Homologene: 3395
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MYH-2B, Minmus, Minimsc, Myhsf, MM, MyHC-IIb, MHC2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17884
Homologene: 123880
Name: Ras and Rab interactor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217835
Homologene: 11748
Name: murinoglobulin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17837
Homologene: 136663
Name: keratin 40
Synonyms: Ka36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 406221
Homologene: 46321
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 12401
Homologene: 20417
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 210789
Homologene: 45451
Name: olfactory receptor 1444
Synonyms: MOR202-4, GA_x6K02T2RE5P-3191201-3192160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258697
Homologene: 64906
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225288
VEGA: 18
Homologene: 45323
Name: glycine N-methyltransferase
Synonyms: glycine N methyl transferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14711
Homologene: 7741
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17391
Homologene: 21331
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 622665
Homologene: 77410
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Ped, Qa7, Qa-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 15018
Homologene: 128352
Name: speckle-type BTB/POZ protein-like
Synonyms: 4921517N04Rik, E430033K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76857
Homologene: 78016
Name: olfactory receptor 866
Synonyms: GA_x6K02T2PVTD-13768406-13767468, MOR145-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258551
Homologene: 133687
Name: tetratricopeptide repeat domain 12
Synonyms: E330017O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235330
Homologene: 32375
Name: dehydrogenase/reductase (SDR family) member 7C
Synonyms: 1110001P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68460
Homologene: 19108
Name: transmembrane protein 255B
Synonyms: LOC272465, Fam70b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 272465
Homologene: 18804
Name: acyl-CoA thioesterase 9
Synonyms: p48, 0610041P13Rik, MT-ACT48, U8, Acate2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 56360
Homologene: 8206
Name: NLR family, pyrin domain containing 5, pseudogene
Synonyms: Gm18756
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100417675
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 15207
Homologene: 7358
Name: predicted gene, 25694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,741,780 bp
  • G to T, chromosome 1 at 153,907,103 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • T to C, chromosome 2 at 29,471,342 bp
  • T to C, chromosome 2 at 50,280,224 bp
  • T to C, chromosome 2 at 101,684,546 bp
  • A to G, chromosome 2 at 155,813,988 bp
  • C to T, chromosome 2 at 172,557,182 bp
  • A to G, chromosome 3 at 125,438,358 bp
  • C to A, chromosome 3 at 127,586,100 bp
  • A to T, chromosome 4 at 88,628,892 bp
  • G to T, chromosome 4 at 116,597,241 bp
  • G to A, chromosome 4 at 126,129,751 bp
  • T to C, chromosome 4 at 152,287,085 bp
  • T to C, chromosome 5 at 136,312,993 bp
  • T to A, chromosome 6 at 122,082,752 bp
  • T to A, chromosome 7 at 14,581,049 bp
  • T to A, chromosome 7 at 43,352,276 bp
  • T to C, chromosome 7 at 45,045,914 bp
  • T to A, chromosome 7 at 72,183,851 bp
  • A to G, chromosome 7 at 109,921,383 bp
  • T to A, chromosome 8 at 10,435,869 bp
  • T to C, chromosome 8 at 13,455,998 bp
  • T to C, chromosome 8 at 13,614,587 bp
  • G to C, chromosome 9 at 20,027,733 bp
  • A to G, chromosome 9 at 49,472,405 bp
  • G to A, chromosome 9 at 119,958,819 bp
  • A to G, chromosome 10 at 5,031,768 bp
  • T to C, chromosome 11 at 55,270,097 bp
  • T to C, chromosome 11 at 67,251,752 bp
  • T to C, chromosome 11 at 67,815,880 bp
  • T to C, chromosome 11 at 99,543,074 bp
  • C to A, chromosome 11 at 103,501,798 bp
  • G to T, chromosome 12 at 76,314,990 bp
  • G to A, chromosome 12 at 102,369,680 bp
  • T to C, chromosome 12 at 103,654,067 bp
  • C to T, chromosome 14 at 47,096,109 bp
  • C to T, chromosome 14 at 101,608,336 bp
  • A to G, chromosome 15 at 8,153,673 bp
  • A to C, chromosome 15 at 30,619,874 bp
  • G to A, chromosome 15 at 81,895,285 bp
  • C to T, chromosome 16 at 18,623,392 bp
  • T to A, chromosome 17 at 14,945,115 bp
  • A to T, chromosome 17 at 33,334,703 bp
  • A to T, chromosome 17 at 35,439,530 bp
  • T to C, chromosome 17 at 46,510,941 bp
  • ATTAGGGGATGGTCTTAGGG to ATTAGGG, chromosome 17 at 46,725,736 bp
  • A to T, chromosome 18 at 6,111,774 bp
  • T to A, chromosome 18 at 25,110,239 bp
  • A to G, chromosome 18 at 32,014,229 bp
  • T to C, chromosome 19 at 12,862,669 bp
  • T to A, chromosome X at 155,264,068 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041751-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.