Strain Name:
Stock Number:
Citation ID:
Other Names:
R4498 (G1), C57BL/6J-MtgxR4498Btlr
Major Collection:

Strain Information

Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 108156
VEGA: 12
Homologene: 55940
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170762
VEGA: 15
Homologene: 43155
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11429
Homologene: 856
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75415
Homologene: 23089
Name: proline rich 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233210
Homologene: 18957
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13047
Name: mediator complex subunit 27
Synonyms: 1500015J03Rik, 2310042P07Rik, D2Ertd434e, Crsp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68975
Homologene: 3152
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71643
Homologene: 34708
Name: mitochondrial fission factor
Synonyms: 5230400G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75734
Homologene: 87000
Name: transcription factor AP-2, gamma
Synonyms: Ap-2.2, Stra2, AP2gamma, Tcfap2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21420
Homologene: 2423
Name: methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms: 2010311D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109129
Homologene: 9248
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19414
Homologene: 7217
Name: glutamate-ammonia ligase (glutamine synthetase)
Synonyms: Glns, GS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14645
Homologene: 37567
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224694
Homologene: 138633
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74178
Homologene: 12542
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244049
Homologene: 69254
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233186
Homologene: 50482
Name: PHD finger protein 10
Synonyms: 1810055P05Rik, Baf45a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72057
Homologene: 10112
Name: septin 5
Synonyms: Cdcrel1, Pnutl1, Sept5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18951
VEGA: 16
Homologene: 74446
Name: catenin (cadherin associated protein), delta 2
Synonyms: Nprap, Catnd2, neurojugin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18163
VEGA: 15
Homologene: 55574
Name: sterile alpha motif domain containing 4
Synonyms: 4933436G17Rik, 1700111L17Rik, 1700024G08Rik, Smaug, sunk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74480
Homologene: 19167
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244281
Homologene: 34710
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
Homologene: 1110
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 64580
Homologene: 11208
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78309
Homologene: 56696
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17922
Homologene: 81947
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19347
Homologene: 14584
Name: TNF receptor-associated factor 6
Synonyms: 2310003F17Rik, C630032O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22034
Homologene: 3395
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17884
Homologene: 123880
Name: Ras and Rab interactor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217835
Homologene: 11748
Name: murinoglobulin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17837
Homologene: 136663
Name: keratin 40
Synonyms: Ka36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 406221
Homologene: 46321
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 12401
Homologene: 20417
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 210789
Homologene: 45451
Name: olfactory receptor family 5 subfamily B member 21
Synonyms: GA_x6K02T2RE5P-3191201-3192160, MOR202-4, Olfr1444
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258697
Homologene: 64906
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Name: glycine N-methyltransferase
Synonyms: glycine N methyl transferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14711
Homologene: 7741
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17391
Homologene: 21331
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 622665
Homologene: 77410
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Qa-7, Qa7, Ped
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15018
Homologene: 128352
Name: speckle-type BTB/POZ protein-like
Synonyms: E430033K04Rik, 4921517N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76857
Homologene: 78016
Name: olfactory receptor family 7 subfamily E member 173
Synonyms: GA_x6K02T2PVTD-13768406-13767468, MOR145-5, Olfr866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258551
Homologene: 133687
Name: tetratricopeptide repeat domain 12
Synonyms: E330017O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235330
Homologene: 32375
Name: dehydrogenase/reductase (SDR family) member 7C
Synonyms: 1110001P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68460
Homologene: 19108
Name: transmembrane protein 255B
Synonyms: LOC272465, Fam70b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 272465
Homologene: 18804
Name: acyl-CoA thioesterase 9
Synonyms: p48, MT-ACT48, U8, 0610041P13Rik, Acate2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 56360
Homologene: 8206
Name: NLR family, pyrin domain containing 5, pseudogene
Synonyms: Gm18756
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100417675
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15207
Homologene: 7358
Name: predicted gene, 25694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,741,780 bp
  • G to T, chromosome 1 at 153,907,103 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • T to C, chromosome 2 at 29,471,342 bp
  • T to C, chromosome 2 at 50,280,224 bp
  • T to C, chromosome 2 at 101,684,546 bp
  • A to G, chromosome 2 at 155,813,988 bp
  • C to T, chromosome 2 at 172,557,182 bp
  • A to G, chromosome 3 at 125,438,358 bp
  • C to A, chromosome 3 at 127,586,100 bp
  • A to T, chromosome 4 at 88,628,892 bp
  • G to T, chromosome 4 at 116,597,241 bp
  • G to A, chromosome 4 at 126,129,751 bp
  • T to C, chromosome 4 at 152,287,085 bp
  • T to C, chromosome 5 at 136,312,993 bp
  • T to A, chromosome 6 at 122,082,752 bp
  • T to A, chromosome 7 at 14,581,049 bp
  • T to A, chromosome 7 at 43,352,276 bp
  • T to C, chromosome 7 at 45,045,914 bp
  • T to A, chromosome 7 at 72,183,851 bp
  • A to G, chromosome 7 at 109,921,383 bp
  • T to A, chromosome 8 at 10,435,869 bp
  • T to C, chromosome 8 at 13,455,998 bp
  • T to C, chromosome 8 at 13,614,587 bp
  • G to C, chromosome 9 at 20,027,733 bp
  • A to G, chromosome 9 at 49,472,405 bp
  • G to A, chromosome 9 at 119,958,819 bp
  • A to G, chromosome 10 at 5,031,768 bp
  • T to C, chromosome 11 at 55,270,097 bp
  • T to C, chromosome 11 at 67,251,752 bp
  • T to C, chromosome 11 at 67,815,880 bp
  • T to C, chromosome 11 at 99,543,074 bp
  • C to A, chromosome 11 at 103,501,798 bp
  • G to T, chromosome 12 at 76,314,990 bp
  • G to A, chromosome 12 at 102,369,680 bp
  • T to C, chromosome 12 at 103,654,067 bp
  • C to T, chromosome 14 at 47,096,109 bp
  • C to T, chromosome 14 at 101,608,336 bp
  • A to G, chromosome 15 at 8,153,673 bp
  • A to C, chromosome 15 at 30,619,874 bp
  • G to A, chromosome 15 at 81,895,285 bp
  • C to T, chromosome 16 at 18,623,392 bp
  • T to A, chromosome 17 at 14,945,115 bp
  • A to T, chromosome 17 at 33,334,703 bp
  • A to T, chromosome 17 at 35,439,530 bp
  • T to C, chromosome 17 at 46,510,941 bp
  • ATTAGGGGATGGTCTTAGGG to ATTAGGG, chromosome 17 at 46,725,736 bp
  • A to T, chromosome 18 at 6,111,774 bp
  • T to A, chromosome 18 at 25,110,239 bp
  • A to G, chromosome 18 at 32,014,229 bp
  • T to C, chromosome 19 at 12,862,669 bp
  • T to A, chromosome X at 155,264,068 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041751-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.