Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4543Btlr/Mmmh
Stock Number:
041778-MU
Citation ID:
RRID:MMRRC_041778-MU
Other Names:
R4543 (G1), C57BL/6J-MtgxR4543Btlr
Major Collection:

Strain Information

Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Kat2b
Name: K(lysine) acetyltransferase 2B
Synonyms: A930006P13Rik, Pcaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18519
HGNC: HGNC:8638
Homologene: 20834
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Rbfox2
Name: RNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms: Fxh, 2810460A15Rik, Fbm2, Rbm9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 93686
VEGA: 15
HGNC: HGNC:9906
Homologene: 49375
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Immt
Name: inner membrane protein, mitochondrial
Synonyms: P87/89, P89, P87, HMP, 1700082C19Rik, D830041H16Rik, mitofilin, Micos60
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76614
HGNC: HGNC:6047
Homologene: 38234
Zfp622
Name: zinc finger protein 622
Synonyms: 1110033B05Rik, ZPR9, D15Ertd806e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52521
VEGA: 15
Homologene: 74377
Abhd3
Name: abhydrolase domain containing 3
Synonyms: LABH3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106861
Homologene: 14055
Kcnn2
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonyms: small conductance calcium-activated potassium channel 2, SK2, fri, bc
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 140492
HGNC: HGNC:6291
Homologene: 135651
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Il6st
Name: interleukin 6 signal transducer
Synonyms: gp130, CD130, D13Ertd699e, 5133400A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16195
HGNC: HGNC:6021
Homologene: 1645
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Barx2
Name: BarH-like homeobox 2
Synonyms: Barx2b, 2310006E12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12023
HGNC: HGNC:956
Homologene: 2715
Mgat4f
Name: MGAT4 family, member F
Synonyms: 4933406M09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240755
Homologene: 128441
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
A1bg
Name: alpha-1-B glycoprotein
Synonyms: C44
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 117586
VEGA: 15
HGNC: HGNC:5
Homologene: 11167
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Sox21
Name: SRY (sex determining region Y)-box 21
Synonyms: Sox25
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223227
Homologene: 5143
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, abLIM-S, abLIM-M, abLIM-L, 4833406P10Rik, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Tmem132c
Name: transmembrane protein 132C
Synonyms: 4632425D07Rik, 2810482M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208213
Homologene: 76567
Chil3
Name: chitinase-like 3
Synonyms: Ym1, Chi3l3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Fsd1
Name: fibronectin type 3 and SPRY domain-containing protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240121
VEGA: 17
Homologene: 11531
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73813
Homologene: 9791
Lrrcc1
Name: leucine rich repeat and coiled-coil domain containing 1
Synonyms: 4932441F23Rik, 1200008A14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71710
Homologene: 12559
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Clca1
Name: chloride channel accessory 1
Synonyms: gob-5, gob5, Clca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23844
HGNC: HGNC:2015
Homologene: 984
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: GLUT-12, Glut12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353169
Homologene: 59263
Dtwd2
Name: DTW domain containing 2
Synonyms: 8030470C17Rik, 1190002H09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68857
Homologene: 79701
Fads3
Name: fatty acid desaturase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 60527
VEGA: 19
HGNC: HGNC:3576
Homologene: 11025
Crp
Name: C-reactive protein, pentraxin-related
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12944
HGNC: HGNC:2367
Homologene: 128039
Vmn1r88
Name: vomeronasal 1 receptor, 88
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312474
Homologene: 74345
Tmprss11a
Name: transmembrane protease, serine 11a
Synonyms: LOC194597
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 194597
Homologene: 62723
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Or8g51
Name: olfactory receptor family 8 subfamily G member 51
Synonyms: GA_x6K02T2PVTD-32400678-32399743, MOR171-23, Olfr919
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258432
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 92,884,850 bp
  • T to A, chromosome 1 at 134,389,793 bp
  • A to C, chromosome 1 at 172,698,737 bp
  • C to T, chromosome 2 at 121,407,409 bp
  • A to G, chromosome 2 at 126,358,066 bp
  • T to A, chromosome 3 at 14,539,791 bp
  • T to A, chromosome 3 at 59,091,508 bp
  • T to G, chromosome 3 at 106,160,370 bp
  • T to A, chromosome 3 at 144,746,988 bp
  • A to G, chromosome 4 at 74,330,760 bp
  • G to A, chromosome 5 at 86,411,809 bp
  • A to G, chromosome 5 at 127,504,977 bp
  • A to G, chromosome 5 at 134,363,900 bp
  • T to C, chromosome 6 at 71,851,778 bp
  • T to A, chromosome 7 at 13,177,980 bp
  • C to T, chromosome 7 at 45,726,905 bp
  • G to A, chromosome 7 at 79,707,548 bp
  • A to G, chromosome 7 at 96,895,815 bp
  • GCGGCGGCG to GCGGCGGCGTCGGCGGCG, chromosome 7 at 97,579,922 bp
  • T to C, chromosome 9 at 15,335,253 bp
  • A to G, chromosome 9 at 31,846,796 bp
  • A to G, chromosome 9 at 38,697,545 bp
  • T to A, chromosome 10 at 22,664,786 bp
  • C to A, chromosome 11 at 83,324,650 bp
  • T to C, chromosome 11 at 102,213,944 bp
  • T to A, chromosome 13 at 98,075,000 bp
  • G to A, chromosome 13 at 112,481,459 bp
  • T to C, chromosome 14 at 30,661,333 bp
  • CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC to CCAGCGGCGGCGGCGGCAGCGGC, chromosome 14 at 118,235,136 bp
  • T to A, chromosome 15 at 25,991,537 bp
  • A to T, chromosome 15 at 60,917,900 bp
  • A to T, chromosome 15 at 77,306,368 bp
  • T to C, chromosome 16 at 37,060,785 bp
  • C to T, chromosome 17 at 33,999,558 bp
  • T to C, chromosome 17 at 53,653,140 bp
  • C to T, chromosome 17 at 55,997,604 bp
  • T to A, chromosome 17 at 57,406,874 bp
  • T to C, chromosome 18 at 10,706,672 bp
  • T to C, chromosome 18 at 45,559,648 bp
  • C to A, chromosome 18 at 49,724,108 bp
  • T to C, chromosome 19 at 10,041,811 bp
  • C to T, chromosome 19 at 57,077,442 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4543 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041778-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.