Strain Name:
C57BL/6J-MtgxR4604Btlr/Mmmh
Stock Number:
041816-MU
Citation ID:
RRID:MMRRC_041816-MU
Other Names:
R4604 (G1), C57BL/6J-MtgxR4604Btlr
Major Collection:

Gene Information

Dnm2
Name: dynamin 2
Synonyms: Dyn2, b2b2159Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13430
HGNC: HGNC:2974
Homologene: 90883
Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Lamb1
Name: laminin B1
Synonyms: D130003D08Rik, C80098, C81607, Lamb-1, Lamb1-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Npy2r
Name: neuropeptide Y receptor Y2
Synonyms: NPY-Y2 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18167
HGNC: HGNC:7957
Homologene: 701
Pcdh9
Name: protocadherin 9
Synonyms: A730003J17Rik, 1500001L12Rik, LOC382930, C630029H24Rik, C530050I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 171286
Homologene: 11628
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224647
Homologene: 32575
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53625
Homologene: 4797
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68420
Homologene: 23814
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: A630020C16Rik, 4930502N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74996
Homologene: 9929
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56542
Homologene: 69218
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 4930432B04Rik, D730027C18Rik, 3110043H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75786
Homologene: 8844
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 4931431C02Rik, 2410095B20Rik, C330023D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Dock9
Name: dedicator of cytokinesis 9
Synonyms: Zizimin1, D14Wsu89e, B230309H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105445
Homologene: 41026
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: Fnbp3, FBP11, 2810012K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56194
Homologene: 6377
Sall1
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 58198
Homologene: 2230
Atxn2
Name: ataxin 2
Synonyms: ATX2, Sca2, 9630045M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20239
Homologene: 2234
Xpo6
Name: exportin 6
Synonyms: C230091E20Rik, Ranbp20, 2610005L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74204
Homologene: 12544
Hspa5
Name: heat shock protein 5
Synonyms: Hsce70, Bip, D2Wsu141e, D2Wsu17e, baffled, Sez7, 78kDa, XAP-1 antigen, mBiP, Grp78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Ruvbl1
Name: RuvB-like protein 1
Synonyms: Tip49a, 2510009G06Rik, Pontin52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56505
Homologene: 37839
Ets2
Name: E26 avian leukemia oncogene 2, 3' domain
Synonyms: Ets-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 23872
HGNC: HGNC:3489
Homologene: 3838
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, 2610001E17Rik, Ssg1, DRO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67896
Homologene: 12206
Cdca8
Name: cell division cycle associated 8
Synonyms: Borealin, D4Ertd421e, DasraB, 4831429J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 52276
Homologene: 23075
Ankrd27
Name: ankyrin repeat domain 27 (VPS9 domain)
Synonyms: Varp, D330003H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 245886
Homologene: 12956
Slc22a3
Name: solute carrier family 22 (organic cation transporter), member 3
Synonyms: EMT, Orct3, Oct3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20519
VEGA: 17
Homologene: 22630
Fbf1
Name: Fas (TNFRSF6) binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217335
Homologene: 16531
Gper1
Name: G protein-coupled estrogen receptor 1
Synonyms: Gper, FEG-1, CMKRL2, GPCR-Br, Ceprl, 6330420K13Rik, Gpr30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76854
HGNC: HGNC:4485
Homologene: 15855
Acp6
Name: acid phosphatase 6, lysophosphatidic
Synonyms: mPACPL1, ACPL1, 5730559A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66659
Homologene: 41128
Nmbr
Name: neuromedin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18101
HGNC: HGNC:7843
Homologene: 20560
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: D130058I17Rik, p97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14389
Homologene: 69067
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: 2510015P22Rik, Cisk, cytokine-independent survival kinase, fy, A330005P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170755
Homologene: 56582
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74342
Homologene: 41763
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243168
Homologene: 71549
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: GluRgamma1, KA-1, 6330551K01Rik, KA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Mcm4
Name: minichromosome maintenance complex component 4
Synonyms: Cdc21, mCdc21, 19G, Mcmd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17217
VEGA: 16
HGNC: HGNC:6947
Homologene: 40496
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: b2b414Clo, 4432416O06Rik, m407Asp, DHC2, DHC1b, D330044F14Rik, Dnchc2, D030010H02Rik, m152Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Mknk1
Name: MAP kinase-interacting serine/threonine kinase 1
Synonyms: Mnk1, 2410048M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17346
HGNC: HGNC:7110
Homologene: 37838
Znrf2
Name: zinc and ring finger 2
Synonyms: D6Ertd365e, 1190002C14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387524
Homologene: 15668
Cfap97
Name: cilia and flagella associated protein 97
Synonyms: 4933411K20Rik, 1110068E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66756
Homologene: 12026
Fbxo7
Name: F-box protein 7
Synonyms: 2410015K21Rik, A230052G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 69754
Homologene: 8136
Wrnip1
Name: Werner helicase interacting protein 1
Synonyms: WHIP, 4833444L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 78903
Homologene: 10592
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 5830412M15Rik, 9930026A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: Hapip, E530005C20Rik, 2210407G14Rik, LOC224126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Uncx
Name: UNC homeobox
Synonyms: Chx4, Uncx4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22255
Homologene: 56598
Cep192
Name: centrosomal protein 192
Synonyms: 4631422C13Rik, D430014P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Abcb6
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms: 1200005B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74104
HGNC: HGNC:47
Homologene: 11375
Dclk3
Name: doublecortin-like kinase 3
Synonyms: Click-I, -II related, Dcamkl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245038
Homologene: 70580
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: USH1D, bob, nmf252, nmf181, sals, nmf112, 4930542A03Rik, mdfw, ahl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Irak2
Name: interleukin-1 receptor-associated kinase 2
Synonyms: IRAK-2, 6330415L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108960
HGNC: HGNC:6113
Homologene: 1207
Cfap70
Name: cilia and flagella associated protein 70
Synonyms: 5330402L21Rik, Ttc18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76670
Homologene: 17048
Ttn
Name: titin
Synonyms: 2310057K23Rik, connectin, D830007G01Rik, D330041I19Rik, L56, shru, 1100001C23Rik, 2310036G12Rik, mdm, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, Nesp2g, Cpfl8, diminished cone electroretinogram, dice, 6820443O06Rik, D12Ertd777e, syne-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Setd1b
Name: SET domain containing 1B
Synonyms: KMT2G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208043
Homologene: 134654
Gstm3
Name: glutathione S-transferase, mu 3
Synonyms: mGSTM5, Fsc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14864
Homologene: 37356
Wdr24
Name: WD repeat domain 24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268933
Homologene: 6870
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78309
Homologene: 56696
Btnl6
Name: butyrophilin-like 6
Synonyms: NG13, Gm6519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 624681
Homologene: 106849
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Csf1
Name: colony stimulating factor 1 (macrophage)
Synonyms: Csfm, CSF-1, M-CSF, colony-stimulating factor-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12977
HGNC: HGNC:2432
Homologene: 7282
Zfp941
Name: zinc finger protein 941
Synonyms: BC066028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 407812
Hcn3
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 3
Synonyms: Hac3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15168
Homologene: 22453
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: OTTMUSG00000005786, LOC380698
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ltf
Name: lactotransferrin
Synonyms: Lf, lactoferrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17002
HGNC: HGNC:6720
Homologene: 1754
Rpgrip1
Name: retinitis pigmentosa GTPase regulator interacting protein 1
Synonyms: 4930505G06Rik, nmf247, A930002K18Rik, 4930401L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 77945
Homologene: 10679
Nhsl1
Name: NHS-like 1
Synonyms: 5730409E15Rik, A630035H13Rik, D10Bwg0940e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215819
Homologene: 27834
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: 5730407I04Rik, Mtsh1, NY-CO-33, D18Bwg1409e, teashirt1, Sdccag33, Tsh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 110796
Homologene: 4227
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Sec22c
Name: SEC22 homolog C, vesicle trafficking protein
Synonyms: 5930407I15Rik, Sec22l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 215474
Homologene: 41948
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, BK channel alpha subunit, BKCa, MaxiK, mSlo1, Slo1, 5730414M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Defb26
Name: defensin beta 26
Synonyms: EG654457
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 654457
Homologene: 86850
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69700
Homologene: 43567
Serpina3i
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3I
Synonyms: 2B2, Gm6930, alpha-1 antiproteinase, antitrypsin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 628900
HGNC: HGNC:16
Homologene: 115927
Tctn2
Name: tectonic family member 2
Synonyms: Tect2, 4432405B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67978
Homologene: 11729
Prrt3
Name: proline-rich transmembrane protein 3
Synonyms: B230206N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 210673
Homologene: 52099
Myo1a
Name: myosin IA
Synonyms: Myhl, brush border myosin 1, BBM-I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Speg
Name: SPEG complex locus
Synonyms: SPEGalpha, D1Bwg1450e, SPEGbeta, BPEG, SPEG, Apeg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11790
Homologene: 55619
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Rnf130
Name: ring finger protein 130
Synonyms: G1RZFP, G1RP, 2510042A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 59044
Homologene: 41267
Adam26a
Name: a disintegrin and metallopeptidase domain 26A (testase 3)
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13525
Homologene: 128363
Txndc17
Name: thioredoxin domain containing 17
Synonyms: Txnl5, D11Ertd672e, TRP14, 4831443O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 52700
Homologene: 41683
Prm2
Name: protamine 2
Synonyms: Prm-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19119
HGNC: HGNC:9448
Sting1
Name: stimulator of interferon response cGAMP interactor 1
Synonyms: MPYS, ERIS, 2610307O08Rik, Tmem173, Sting
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72512
VEGA: 18
Homologene: 18868
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Colq
Name: collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 102639719
HGNC: HGNC:2226
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Spsb4
Name: splA/ryanodine receptor domain and SOCS box containing 4
Synonyms: D030068E18Rik, Ssb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 211949
Homologene: 25315
Pde11a
Name: phosphodiesterase 11A
Synonyms: 6330414F14Rik, A630086N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Tlx2
Name: T cell leukemia, homeobox 2
Synonyms: Tlx1l1, NCX, Hox11l1, Hox11L.1, Ncx1, Enx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21909
HGNC: HGNC:5057
Homologene: 7575
Cyp2c55
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72082
HGNC: HGNC:2620
Homologene: 133567
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Upb1
Name: ureidopropionase, beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103149
Homologene: 9471
Prkag2
Name: protein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms: 2410051C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108099
HGNC: HGNC:9386
Homologene: 136125
Olfr1019
Name: olfactory receptor 1019
Synonyms: MOR180-1, GA_x6K02T2Q125-47320309-47319377
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259017
Homologene: 17464
Mfhas1
Name: malignant fibrous histiocytoma amplified sequence 1
Synonyms: 2310066G09Rik, D8Ertd91e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 52065
Homologene: 3114
Prr5l
Name: proline rich 5 like
Synonyms: 4833411O04Rik, 2600010E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72446
Homologene: 11753
Psg25
Name: pregnancy-specific glycoprotein 25
Synonyms: cea13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114868
Homologene: 110989
Tekt4
Name: tektin 4
Synonyms: 1700010L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71840
Homologene: 25745
Ubqln3
Name: ubiquilin 3
Synonyms: 4933400K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244178
Homologene: 9700
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HS1-associated protein X-1, HAX-1, Hs1bp1, Silg111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Oosp2
Name: oocyte secreted protein 2
Synonyms: Tmem122, Plac1l, LOC225922
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225922
Homologene: 52157
Plekha2
Name: pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms: TAPP2, 6430512N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 83436
Homologene: 41822
Pstk
Name: phosphoseryl-tRNA kinase
Synonyms: 5730458D16Rik, 5430423O14Rik, LOC381976
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 214580
Homologene: 45167
Ceacam16
Name: carcinoembryonic antigen-related cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330483
Homologene: 19857
Gfy
Name: golgi-associated olfactory signaling regulator
Synonyms: Goofy, Gm581
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100039953
Homologene: 85248
4930518I15Rik
Name: RIKEN cDNA 4930518I15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Mir7028
Name: microRNA 7028
Synonyms: mmu-mir-7028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102465622
VEGA: 5
Gm3287
Name: predicted gene 3287
Synonyms: Gm3291, Gm3296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,885,717 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATA, chromosome 1 at 63,151,739 bp
  • G to A, chromosome 1 at 75,179,877 bp
  • T to A, chromosome 1 at 75,426,923 bp
  • A to G, chromosome 1 at 180,109,194 bp
  • A to G, chromosome 2 at 34,773,844 bp
  • A to T, chromosome 2 at 53,142,023 bp
  • G to T, chromosome 2 at 76,337,793 bp
  • A to T, chromosome 2 at 76,870,461 bp
  • C to T, chromosome 2 at 85,841,182 bp
  • A to T, chromosome 2 at 91,578,131 bp
  • A to T, chromosome 2 at 101,729,448 bp
  • A to C, chromosome 2 at 104,439,329 bp
  • T to A, chromosome 2 at 152,508,184 bp
  • C to T, chromosome 2 at 156,857,154 bp
  • A to G, chromosome 3 at 82,541,058 bp
  • A to T, chromosome 3 at 89,150,440 bp
  • G to T, chromosome 3 at 89,520,420 bp
  • A to T, chromosome 3 at 89,997,460 bp
  • A to G, chromosome 3 at 97,175,759 bp
  • T to C, chromosome 3 at 107,756,962 bp
  • G to A, chromosome 3 at 107,968,197 bp
  • C to T, chromosome 3 at 153,872,283 bp
  • A to G, chromosome 4 at 115,878,027 bp
  • A to G, chromosome 4 at 124,919,696 bp
  • T to A, chromosome 5 at 24,878,734 bp
  • A to C, chromosome 5 at 88,504,283 bp
  • G to T, chromosome 5 at 103,956,258 bp
  • G to A, chromosome 5 at 114,719,573 bp
  • A to T, chromosome 5 at 114,804,425 bp
  • G to T, chromosome 5 at 121,781,343 bp
  • TCCACCACCACCACCACCACCACCA to TCCACCACCACCACCACCACCA, chromosome 5 at 123,152,074 bp
  • A to T, chromosome 5 at 124,608,616 bp
  • A to G, chromosome 5 at 139,426,725 bp
  • A to T, chromosome 5 at 139,544,082 bp
  • T to C, chromosome 6 at 51,451,012 bp
  • T to A, chromosome 6 at 54,878,440 bp
  • A to G, chromosome 6 at 73,129,660 bp
  • A to T, chromosome 6 at 77,244,144 bp
  • A to C, chromosome 6 at 83,068,760 bp
  • T to C, chromosome 6 at 88,485,905 bp
  • C to A, chromosome 6 at 113,498,237 bp
  • T to A, chromosome 6 at 113,672,887 bp
  • T to C, chromosome 7 at 18,529,803 bp
  • T to A, chromosome 7 at 19,857,508 bp
  • C to T, chromosome 7 at 35,628,490 bp
  • T to A, chromosome 7 at 45,177,188 bp
  • A to G, chromosome 7 at 97,304,213 bp
  • A to G, chromosome 7 at 104,142,491 bp
  • T to C, chromosome 7 at 112,101,831 bp
  • T to C, chromosome 7 at 126,113,752 bp
  • G to A, chromosome 7 at 126,448,623 bp
  • C to A, chromosome 7 at 131,374,015 bp
  • G to A, chromosome 7 at 140,812,211 bp
  • T to A, chromosome 8 at 25,059,835 bp
  • T to C, chromosome 8 at 35,588,610 bp
  • A to G, chromosome 8 at 43,570,051 bp
  • T to C, chromosome 8 at 46,170,447 bp
  • T to A, chromosome 8 at 89,030,341 bp
  • T to C, chromosome 9 at 7,140,995 bp
  • T to C, chromosome 9 at 21,108,009 bp
  • T to C, chromosome 9 at 21,504,664 bp
  • A to G, chromosome 9 at 21,802,540 bp
  • T to C, chromosome 9 at 42,524,586 bp
  • A to G, chromosome 9 at 78,157,709 bp
  • C to A, chromosome 9 at 96,995,878 bp
  • A to T, chromosome 9 at 111,022,341 bp
  • A to T, chromosome 9 at 111,469,185 bp
  • T to C, chromosome 9 at 121,695,642 bp
  • C to T, chromosome 10 at 14,770,164 bp
  • A to C, chromosome 10 at 18,531,410 bp
  • T to G, chromosome 10 at 60,337,666 bp
  • T to C, chromosome 10 at 75,415,025 bp
  • T to G, chromosome 10 at 86,046,802 bp
  • T to C, chromosome 10 at 127,711,138 bp
  • T to TTCACAAA, chromosome 11 at 22,836,426 bp
  • T to C, chromosome 11 at 50,093,777 bp
  • C to T, chromosome 11 at 59,080,205 bp
  • T to C, chromosome 11 at 59,122,746 bp
  • T to A, chromosome 11 at 72,209,448 bp
  • A to T, chromosome 11 at 116,158,922 bp
  • A to C, chromosome 12 at 31,278,776 bp
  • A to G, chromosome 12 at 75,967,710 bp
  • A to G, chromosome 12 at 81,379,213 bp
  • A to T, chromosome 12 at 104,267,777 bp
  • A to G, chromosome 13 at 32,802,347 bp
  • C to T, chromosome 13 at 42,159,749 bp
  • A to T, chromosome 13 at 68,564,512 bp
  • G to T, chromosome 14 at 20,443,661 bp
  • A to G, chromosome 14 at 23,309,038 bp
  • A to T, chromosome 14 at 31,545,103 bp
  • A to T, chromosome 14 at 44,026,172 bp
  • T to C, chromosome 14 at 52,119,397 bp
  • T to C, chromosome 14 at 93,887,180 bp
  • G to T, chromosome 14 at 121,668,459 bp
  • A to G, chromosome 15 at 23,474,368 bp
  • A to T, chromosome 15 at 48,004,815 bp
  • G to T, chromosome 15 at 71,952,339 bp
  • G to T, chromosome 16 at 10,791,749 bp
  • A to G, chromosome 16 at 15,629,663 bp
  • T to A, chromosome 16 at 33,608,159 bp
  • G to A, chromosome 16 at 34,513,926 bp
  • T to A, chromosome 16 at 45,095,565 bp
  • T to A, chromosome 16 at 77,115,415 bp
  • T to C, chromosome 16 at 95,716,269 bp
  • A to G, chromosome 17 at 12,459,771 bp
  • T to A, chromosome 17 at 25,471,775 bp
  • T to A, chromosome 17 at 25,828,505 bp
  • T to C, chromosome 17 at 27,820,315 bp
  • T to A, chromosome 17 at 34,508,461 bp
  • C to A, chromosome 17 at 46,530,146 bp
  • T to A, chromosome 18 at 35,738,690 bp
  • T to A, chromosome 18 at 67,815,922 bp
  • C to A, chromosome 18 at 84,013,374 bp
  • A to C, chromosome 19 at 11,649,683 bp
  • A to G, chromosome 19 at 39,031,386 bp
  • A to T, chromosome 19 at 48,693,914 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4604 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041816-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.