Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4604Btlr/Mmmh
Stock Number:
041816-MU
Citation ID:
RRID:MMRRC_041816-MU
Other Names:
R4604 (G1), C57BL/6J-MtgxR4604Btlr
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Npy2r
Name: neuropeptide Y receptor Y2
Synonyms: NPY-Y2 receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18167
HGNC: HGNC:7957
Homologene: 701
Pcdh9
Name: protocadherin 9
Synonyms: C630029H24Rik, 1500001L12Rik, LOC382930, A730003J17Rik, C530050I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,885,717 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATA, chromosome 1 at 63,151,739 bp
  • G to A, chromosome 1 at 75,179,877 bp
  • T to A, chromosome 1 at 75,426,923 bp
  • A to G, chromosome 1 at 180,109,194 bp
  • A to G, chromosome 2 at 34,773,844 bp
  • A to T, chromosome 2 at 53,142,023 bp
  • G to T, chromosome 2 at 76,337,793 bp
  • A to T, chromosome 2 at 76,870,461 bp
  • C to T, chromosome 2 at 85,841,182 bp
  • A to T, chromosome 2 at 91,578,131 bp
  • A to T, chromosome 2 at 101,729,448 bp
  • A to C, chromosome 2 at 104,439,329 bp
  • T to A, chromosome 2 at 152,508,184 bp
  • C to T, chromosome 2 at 156,857,154 bp
  • A to G, chromosome 3 at 82,541,058 bp
  • A to T, chromosome 3 at 89,150,440 bp
  • G to T, chromosome 3 at 89,520,420 bp
  • A to T, chromosome 3 at 89,997,460 bp
  • A to G, chromosome 3 at 97,175,759 bp
  • T to C, chromosome 3 at 107,756,962 bp
  • G to A, chromosome 3 at 107,968,197 bp
  • C to T, chromosome 3 at 153,872,283 bp
  • A to G, chromosome 4 at 115,878,027 bp
  • A to G, chromosome 4 at 124,919,696 bp
  • T to A, chromosome 5 at 24,878,734 bp
  • A to C, chromosome 5 at 88,504,283 bp
  • G to T, chromosome 5 at 103,956,258 bp
  • G to A, chromosome 5 at 114,719,573 bp
  • A to T, chromosome 5 at 114,804,425 bp
  • G to T, chromosome 5 at 121,781,343 bp
  • TCCACCACCACCACCACCACCACCA to TCCACCACCACCACCACCACCA, chromosome 5 at 123,152,074 bp
  • A to T, chromosome 5 at 124,608,616 bp
  • A to G, chromosome 5 at 139,426,725 bp
  • A to T, chromosome 5 at 139,544,082 bp
  • T to C, chromosome 6 at 51,451,012 bp
  • T to A, chromosome 6 at 54,878,440 bp
  • A to G, chromosome 6 at 73,129,660 bp
  • A to T, chromosome 6 at 77,244,144 bp
  • A to C, chromosome 6 at 83,068,760 bp
  • T to C, chromosome 6 at 88,485,905 bp
  • C to A, chromosome 6 at 113,498,237 bp
  • T to A, chromosome 6 at 113,672,887 bp
  • T to C, chromosome 7 at 18,529,803 bp
  • T to A, chromosome 7 at 19,857,508 bp
  • C to T, chromosome 7 at 35,628,490 bp
  • T to A, chromosome 7 at 45,177,188 bp
  • A to G, chromosome 7 at 97,304,213 bp
  • A to G, chromosome 7 at 104,142,491 bp
  • T to C, chromosome 7 at 112,101,831 bp
  • T to C, chromosome 7 at 126,113,752 bp
  • G to A, chromosome 7 at 126,448,623 bp
  • C to A, chromosome 7 at 131,374,015 bp
  • G to A, chromosome 7 at 140,812,211 bp
  • T to A, chromosome 8 at 25,059,835 bp
  • T to C, chromosome 8 at 35,588,610 bp
  • A to G, chromosome 8 at 43,570,051 bp
  • T to C, chromosome 8 at 46,170,447 bp
  • T to A, chromosome 8 at 89,030,341 bp
  • T to C, chromosome 9 at 7,140,995 bp
  • T to C, chromosome 9 at 21,108,009 bp
  • T to C, chromosome 9 at 21,504,664 bp
  • A to G, chromosome 9 at 21,802,540 bp
  • T to C, chromosome 9 at 42,524,586 bp
  • A to G, chromosome 9 at 78,157,709 bp
  • C to A, chromosome 9 at 96,995,878 bp
  • A to T, chromosome 9 at 111,022,341 bp
  • A to T, chromosome 9 at 111,469,185 bp
  • T to C, chromosome 9 at 121,695,642 bp
  • C to T, chromosome 10 at 14,770,164 bp
  • A to C, chromosome 10 at 18,531,410 bp
  • T to G, chromosome 10 at 60,337,666 bp
  • T to C, chromosome 10 at 75,415,025 bp
  • T to G, chromosome 10 at 86,046,802 bp
  • T to C, chromosome 10 at 127,711,138 bp
  • T to TTCACAAA, chromosome 11 at 22,836,426 bp
  • T to C, chromosome 11 at 50,093,777 bp
  • C to T, chromosome 11 at 59,080,205 bp
  • T to C, chromosome 11 at 59,122,746 bp
  • T to A, chromosome 11 at 72,209,448 bp
  • A to T, chromosome 11 at 116,158,922 bp
  • A to C, chromosome 12 at 31,278,776 bp
  • A to G, chromosome 12 at 75,967,710 bp
  • A to G, chromosome 12 at 81,379,213 bp
  • A to T, chromosome 12 at 104,267,777 bp
  • A to G, chromosome 13 at 32,802,347 bp
  • C to T, chromosome 13 at 42,159,749 bp
  • A to T, chromosome 13 at 68,564,512 bp
  • G to T, chromosome 14 at 20,443,661 bp
  • A to G, chromosome 14 at 23,309,038 bp
  • A to T, chromosome 14 at 31,545,103 bp
  • A to T, chromosome 14 at 44,026,172 bp
  • T to C, chromosome 14 at 52,119,397 bp
  • T to C, chromosome 14 at 93,887,180 bp
  • G to T, chromosome 14 at 121,668,459 bp
  • A to G, chromosome 15 at 23,474,368 bp
  • A to T, chromosome 15 at 48,004,815 bp
  • G to T, chromosome 15 at 71,952,339 bp
  • G to T, chromosome 16 at 10,791,749 bp
  • A to G, chromosome 16 at 15,629,663 bp
  • T to A, chromosome 16 at 33,608,159 bp
  • G to A, chromosome 16 at 34,513,926 bp
  • T to A, chromosome 16 at 45,095,565 bp
  • T to A, chromosome 16 at 77,115,415 bp
  • T to C, chromosome 16 at 95,716,269 bp
  • A to G, chromosome 17 at 12,459,771 bp
  • T to A, chromosome 17 at 25,471,775 bp
  • T to A, chromosome 17 at 25,828,505 bp
  • T to C, chromosome 17 at 27,820,315 bp
  • T to A, chromosome 17 at 34,508,461 bp
  • C to A, chromosome 17 at 46,530,146 bp
  • T to A, chromosome 18 at 35,738,690 bp
  • T to A, chromosome 18 at 67,815,922 bp
  • C to A, chromosome 18 at 84,013,374 bp
  • A to C, chromosome 19 at 11,649,683 bp
  • A to G, chromosome 19 at 39,031,386 bp
  • A to T, chromosome 19 at 48,693,914 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4604 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041816-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.