Strain Name:
C57BL/6J-MtgxR4700Btlr/Mmmh
Stock Number:
041948-MU
Citation ID:
RRID:MMRRC_041948-MU
Other Names:
R4700 (G1), C57BL/6J-MtgxR4700Btlr
Major Collection:

Gene Information

Adamts20
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223838
Homologene: 11808
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: D17Wsu76e, PREP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Tln2
Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 70549
VEGA: 9
Homologene: 56692
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MYH-beta/slow, MyHC-I, Myhc-b, Myhcb, B-MHC, beta-MHC, betaMHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: 6330404F12Rik, GAD(65), GAD65, Gad-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 13824
VEGA: 18
Homologene: 8398
Zfp423
Name: zinc finger protein 423
Synonyms: ataxia1, Roaz, Ebfaz, Zfp104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 94187
Homologene: 9010
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: G630026H09Rik, Srisnf2l, Arip4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 81000
Homologene: 56698
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: slip, DNA-PK, DNAPDcs, dxnph, DOXNPH, DNA-PKcs, XRCC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Tsnax
Name: translin-associated factor X
Synonyms: Trax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 53424
Homologene: 4374
Fryl
Name: FRY like transcription coactivator
Synonyms: 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72313
Homologene: 103956
Fos
Name: FBJ osteosarcoma oncogene
Synonyms: c-fos, cFos, D12Rfj1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 14281
HGNC: HGNC:3796
Homologene: 3844
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21e, 2610202A04Rik, D16Ium21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 22129
Homologene: 2487
Ddx4
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Synonyms: VASA, Mvh, mvh / m'vasa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 13206
VEGA: 13
Homologene: 49227
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68617
Homologene: 41017
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: c-Cbl, 4732447J05Rik, Cbl-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230082
Homologene: 41505
Med29
Name: mediator complex subunit 29
Synonyms: 2810405O22Rik, Ixl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67224
Homologene: 12102
Acy1
Name: aminoacylase 1
Synonyms: 1110014J22Rik, Acy-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 109652
HGNC: HGNC:177
Homologene: 110440
Clcn5
Name: chloride channel, voltage-sensitive 5
Synonyms: Clc5, D930009B12Rik, Clc4-1, Sfc13, DXImx42e, ClC-5, 5430408K11Rik, Clcn4-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 12728
HGNC: HGNC:2023
Homologene: 73872
Ift122
Name: intraflagellar transport 122
Synonyms: Wdr10, sopb, C86139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 81896
Homologene: 12819
Tmeff1
Name: transmembrane protein with EGF-like and two follistatin-like domains 1
Synonyms: tomoregulin-like, M7365
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230157
Homologene: 130458
Dsg4
Name: desmoglein 4
Synonyms: CDHF13, lah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 16769
Homologene: 65341
St3gal3
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Synonyms: ST3Gal III, Siat6, Siat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 20441
Homologene: 7539
Hjurp
Name: Holliday junction recognition protein
Synonyms: A730008H23Rik, C330011F01Rik, 6430706D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381280
Homologene: 10184
Cthrc1
Name: collagen triple helix repeat containing 1
Synonyms: 1110014B07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 68588
Homologene: 16320
Map2
Name: microtubule-associated protein 2
Synonyms: repro4, Mtap2, G1-397-34, MAP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Lsg1
Name: large 60S subunit nuclear export GTPase 1
Synonyms: D16Bwg1547e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224092
Homologene: 5917
Cdc7
Name: cell division cycle 7 (S. cerevisiae)
Synonyms: Cdc7l1, Cdc7, muCdc7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12545
HGNC: HGNC:1745
Homologene: 31166
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 59035
Homologene: 10990
Vps26b
Name: VPS26 retromer complex component B
Synonyms: 2310075A12Rik, 1810012I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 69091
VEGA: 9
Homologene: 3601
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 2900057D21Rik, 7330406P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 72993
Homologene: 32143
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 77264
Homologene: 3723
Cnih4
Name: cornichon family AMPA receptor auxiliary protein 4
Synonyms: D530030D03Rik, E430023H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98417
Homologene: 5932
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, D630037F22Rik, b2b2284Clo, C6orf170
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 544696
VEGA: 10
Homologene: 51889
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229473
Homologene: 9057
Znhit3
Name: zinc finger, HIT type 3
Synonyms: Trip3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 448850
Homologene: 37964
Trpv1
Name: transient receptor potential cation channel, subfamily V, member 1
Synonyms: Vr1, VR-1, OTRPC1, capsaicin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 193034
Homologene: 12920
Clu
Name: clusterin
Synonyms: SP-40, D14Ucla3, Apolipoprotein J, ApoJ, Sgp-2, Cli, Sugp-2, Sgp2, complement lysis inhibitor, testosterone repressed prostate message-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 12759
HGNC: HGNC:2095
Homologene: 1382
St6galnac4
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Synonyms: Siat7d, ST6GalNAc IV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20448
Homologene: 7939
E2f1
Name: E2F transcription factor 1
Synonyms: E2F-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 13555
HGNC: HGNC:3113
Homologene: 3828
Grm2
Name: glutamate receptor, metabotropic 2
Synonyms: 4930441L02Rik, mGluR2, Gprc1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 108068
HGNC: HGNC:4594
Homologene: 20229
Stag3
Name: stromal antigen 3
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 50878
Homologene: 40844
F10
Name: coagulation factor X
Synonyms: Cf10, AI194738, fX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268379
Homologene: 27991
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231125
Homologene: 15119
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 674895
Homologene: 130947
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, 4833413O10Rik, Polydom, D430029O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 64817
Homologene: 23386
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC382129, 9430076A06Rik, LOC234973, D430038H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270120
VEGA: 9
Homologene: 82252
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Birc1e, Naip-rs3, Lgn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 246177
Homologene: 27996
Nav3
Name: neuron navigator 3
Synonyms: 9630020C08Rik, Pomfil1p, 4732483H20Rik, unc53H3, steerin 3, POMFIL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 260315
Homologene: 56688
Oc90
Name: otoconin 90
Synonyms: PLA2L, Ocn-95, Pla2ll
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18256
HGNC: HGNC:8100
Homologene: 19021
Trp53i11
Name: transformation related protein 53 inducible protein 11
Synonyms: Tp53i11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 277414
Homologene: 4404
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: Adgrc2, mfmi1, EGFL2, flamingo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241516
Homologene: 110349
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: Wilson protein, WND, Atp7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Il23r
Name: interleukin 23 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 209590
Homologene: 16930
Osbp2
Name: oxysterol binding protein 2
Synonyms: ORP-4, OSBPL1, 1700095P05Rik, C630001G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 74309
HGNC: HGNC:8504
Homologene: 75303
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216560
Homologene: 9299
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 268780
Homologene: 65044
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235505
Homologene: 25183
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Ahnak
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: 1110004P15Rik, 2310047C17Rik, DY6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Dennd5a
Name: DENN/MADD domain containing 5A
Synonyms: ORF37, Rab6ip1, 1500012B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19347
Homologene: 14584
Cep162
Name: centrosomal protein 162
Synonyms: 4922501C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 382090
Homologene: 8930
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: CMF608, Adlican2, 6530405F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242050
Homologene: 18712
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b1702Clo, m687Ddg, b2b288Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 213980
Homologene: 32757
Olfr677
Name: olfactory receptor 677
Synonyms: MOR32-11, GA_x6K02T2PBJ9-7685262-7686200
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258355
Homologene: 81596
Myo15b
Name: myosin XVB
Synonyms: LOC380737, LOC217328, E330039G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217328
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67928
Homologene: 86128
Tnfrsf8
Name: tumor necrosis factor receptor superfamily, member 8
Synonyms: CD30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 21941
Homologene: 949
Vmn2r89
Name: vomeronasal 2, receptor 89
Synonyms: V2r10, V2r11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 22301
Cep89
Name: centrosomal protein 89
Synonyms: Ccdc123, 2610507L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 72140
Homologene: 12444
Mylk
Name: myosin, light polypeptide kinase
Synonyms: MLCK108, A930019C19Rik, Mlck, nmMlck, telokin, MLCK210, 9530072E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Myrfl
Name: myelin regulatory factor-like
Synonyms: Gm239, LOC237558
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237558
VEGA: 10
Homologene: 88588
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 209683
Homologene: 41023
Zfp422
Name: zinc finger protein 422
Synonyms: KOX15, Krox25, Krox-25-2, Krox26, Krox-26, 2900028O21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67255
Homologene: 5067
Slfn1
Name: schlafen 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20555
Homologene: 86967
Olfr357
Name: olfactory receptor 357
Synonyms: GA_x6K02T2NLDC-33688556-33689482, MOR138-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258616
HGNC: HGNC:8223
Homologene: 17320
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98733
Pidd1
Name: p53 induced death domain protein 1
Synonyms: Pidd, Lrdd, 1200011D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57913
Homologene: 11220
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68655
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230612
Homologene: 17081
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231396
Homologene: 128251
Ngly1
Name: N-glycanase 1
Synonyms: Png1, 1110002C09Rik, PNGase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 59007
Homologene: 10117
Adamts17
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Synonyms: AU023434
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233332
Homologene: 16373
Olfr878
Name: olfactory receptor 878
Synonyms: GA_x6K02T2PVTD-31600511-31601440, MOR163-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258794
HGNC: HGNC:8473
Homologene: 17395
Vmn1r23
Name: vomeronasal 1 receptor 23
Synonyms: V1rc24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 171197
Homologene: 110825
Dyrk2
Name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms: 1810038L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 69181
VEGA: 10
HGNC: HGNC:3093
Homologene: 48437
Spire1
Name: spire type actin nucleation factor 1
Synonyms: 6030430B19Rik, Spir-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 68166
VEGA: 18
Homologene: 35507
Tubal3
Name: tubulin, alpha-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 238463
VEGA: 13
Homologene: 23488
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240034
VEGA: 17
Mrpl38
Name: mitochondrial ribosomal protein L38
Synonyms: 1110036N21Rik, Rpml3, MRP-L3, 4733401F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 60441
Homologene: 11476
A530084C06Rik
Name: RIKEN cDNA A530084C06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
Slc10a5
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 5
Synonyms: LOC241877
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 241877
Homologene: 78106
Atf4
Name: activating transcription factor 4
Synonyms: C/ATF, Atf-4, TAXREB67, CREB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 11911
VEGA: 15
HGNC: HGNC:786
Homologene: 1266
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: Samd6, 2210417J20Rik, LOC269533, SamCystin, b2b1801.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 75691
Homologene: 19545
Zfp493
Name: zinc finger protein 493
Synonyms: 2900054J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 72958
Jph1
Name: junctophilin 1
Synonyms: JP-1, mitsugumin72, ENSMUSG00000054314
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 57339
Homologene: 10761
Ltc4s
Name: leukotriene C4 synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17001
HGNC: HGNC:6719
Homologene: 7406
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 78749
Homologene: 37121
D730048I06Rik
Name: RIKEN cDNA D730048I06 gene
Synonyms:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
Loxl4
Name: lysyl oxidase-like 4
Synonyms: 4833426I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 67573
Homologene: 12977
Ccdc159
Name: coiled-coil domain containing 159
Synonyms: 2510048L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 67119
VEGA: 9
Homologene: 12084
Sdc1
Name: syndecan 1
Synonyms: Synd1, syn-1, Synd, CD138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20969
Homologene: 2252
Ikbip
Name: IKBKB interacting protein
Synonyms: 1700023M03Rik, 1200009F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 67454
Homologene: 12138
Vmn1r55
Name: vomeronasal 1 receptor 55
Synonyms: LOC236535, LOC384522, V1rd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 384522
Homologene: 41799
Olfr1313
Name: olfactory receptor 1313
Synonyms: MOR245-23, GA_x6K02T2Q125-73119859-73118924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258257
Homologene: 106834
Scgb2b6
Name: secretoglobin, family 2B, member 6
Synonyms: Gm19607, Abpbg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100503242
Homologene: 83171
Gm4925
Name: predicted gene 4925
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237433
Homologene: 104935
B020031M17Rik
Name: RIKEN cDNA B020031M17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 333467
2610034M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 17,091,704 bp
  • A to G, chromosome 1 at 66,410,637 bp
  • A to G, chromosome 1 at 74,570,272 bp
  • A to T, chromosome 1 at 75,503,441 bp
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • A to G, chromosome 1 at 139,198,771 bp
  • A to G, chromosome 1 at 181,166,243 bp
  • A to T, chromosome 2 at 22,673,970 bp
  • G to T, chromosome 2 at 32,587,160 bp
  • C to A, chromosome 2 at 36,997,503 bp
  • C to A, chromosome 2 at 82,987,029 bp
  • G to T, chromosome 2 at 93,199,900 bp
  • A to G, chromosome 2 at 112,071,752 bp
  • C to G, chromosome 2 at 154,564,022 bp
  • C to A, chromosome 3 at 10,335,299 bp
  • T to G, chromosome 3 at 10,335,300 bp
  • A to T, chromosome 3 at 59,320,330 bp
  • C to T, chromosome 3 at 83,899,212 bp
  • T to C, chromosome 3 at 108,397,231 bp
  • T to C, chromosome 4 at 41,118,944 bp
  • T to A, chromosome 4 at 47,033,127 bp
  • A to T, chromosome 4 at 48,636,869 bp
  • T to C, chromosome 4 at 58,097,323 bp
  • A to T, chromosome 4 at 111,890,937 bp
  • C to T, chromosome 4 at 117,960,035 bp
  • T to C, chromosome 4 at 145,303,122 bp
  • G to T, chromosome 5 at 34,217,845 bp
  • T to C, chromosome 5 at 73,065,538 bp
  • A to T, chromosome 5 at 87,092,442 bp
  • T to C, chromosome 5 at 106,973,841 bp
  • T to C, chromosome 5 at 111,277,043 bp
  • T to C, chromosome 5 at 138,296,783 bp
  • A to T, chromosome 6 at 57,926,205 bp
  • T to C, chromosome 6 at 67,473,850 bp
  • C to T, chromosome 6 at 115,862,721 bp
  • C to A, chromosome 6 at 115,958,615 bp
  • C to T, chromosome 6 at 116,626,883 bp
  • A to C, chromosome 7 at 5,146,587 bp
  • G to T, chromosome 7 at 5,146,588 bp
  • A to G, chromosome 7 at 25,363,515 bp
  • T to A, chromosome 7 at 28,386,927 bp
  • T to C, chromosome 7 at 31,619,483 bp
  • A to G, chromosome 7 at 35,438,437 bp
  • T to C, chromosome 7 at 67,041,888 bp
  • A to T, chromosome 7 at 105,056,276 bp
  • T to C, chromosome 7 at 109,921,198 bp
  • T to A, chromosome 7 at 120,312,705 bp
  • T to C, chromosome 7 at 141,442,249 bp
  • G to T, chromosome 8 at 13,039,621 bp
  • A to T, chromosome 8 at 22,000,121 bp
  • T to A, chromosome 8 at 87,781,710 bp
  • T to A, chromosome 8 at 125,028,794 bp
  • A to G, chromosome 9 at 16,031,173 bp
  • A to G, chromosome 9 at 21,587,184 bp
  • A to G, chromosome 9 at 21,927,731 bp
  • T to C, chromosome 9 at 27,015,215 bp
  • A to T, chromosome 9 at 35,789,725 bp
  • A to G, chromosome 9 at 37,918,921 bp
  • A to G, chromosome 9 at 44,173,380 bp
  • A to G, chromosome 9 at 67,346,527 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to C, chromosome 9 at 87,206,862 bp
  • C to T, chromosome 9 at 106,433,583 bp
  • T to A, chromosome 9 at 106,653,931 bp
  • T to C, chromosome 9 at 106,754,025 bp
  • A to G, chromosome 10 at 56,224,649 bp
  • A to G, chromosome 10 at 88,730,637 bp
  • A to G, chromosome 10 at 91,096,152 bp
  • A to G, chromosome 10 at 109,764,935 bp
  • A to G, chromosome 10 at 116,777,342 bp
  • T to C, chromosome 10 at 118,868,286 bp
  • T to C, chromosome 11 at 3,712,160 bp
  • T to C, chromosome 11 at 6,516,785 bp
  • A to G, chromosome 11 at 9,292,306 bp
  • A to G, chromosome 11 at 21,711,719 bp
  • C to A, chromosome 11 at 49,626,444 bp
  • C to T, chromosome 11 at 50,237,081 bp
  • T to C, chromosome 11 at 62,847,788 bp
  • A to T, chromosome 11 at 73,251,284 bp
  • T to C, chromosome 11 at 83,121,649 bp
  • T to C, chromosome 11 at 84,916,329 bp
  • A to C, chromosome 11 at 110,070,482 bp
  • A to T, chromosome 11 at 115,861,935 bp
  • G to A, chromosome 11 at 116,135,152 bp
  • A to G, chromosome 12 at 8,790,541 bp
  • T to C, chromosome 12 at 85,476,162 bp
  • T to A, chromosome 13 at 3,933,514 bp
  • A to G, chromosome 13 at 31,558,812 bp
  • T to C, chromosome 13 at 67,786,617 bp
  • A to G, chromosome 13 at 100,223,414 bp
  • T to C, chromosome 13 at 112,613,735 bp
  • T to C, chromosome 13 at 119,949,842 bp
  • T to A, chromosome 14 at 14,842,841 bp
  • T to C, chromosome 14 at 16,281,809 bp
  • C to A, chromosome 14 at 26,925,971 bp
  • G to A, chromosome 14 at 51,457,485 bp
  • A to G, chromosome 14 at 54,988,321 bp
  • A to T, chromosome 14 at 65,979,864 bp
  • T to C, chromosome 15 at 7,237,776 bp
  • C to T, chromosome 15 at 39,086,708 bp
  • T to A, chromosome 15 at 65,881,505 bp
  • C to T, chromosome 15 at 76,708,585 bp
  • T to A, chromosome 15 at 80,257,417 bp
  • A to T, chromosome 15 at 94,394,622 bp
  • A to T, chromosome 16 at 15,702,112 bp
  • A to G, chromosome 16 at 30,565,449 bp
  • G to T, chromosome 16 at 34,922,435 bp
  • A to G, chromosome 16 at 35,279,216 bp
  • A to G, chromosome 16 at 57,570,695 bp
  • A to G, chromosome 16 at 94,439,241 bp
  • G to A, chromosome 17 at 7,771,480 bp
  • T to C, chromosome 17 at 21,722,407 bp
  • C to T, chromosome 17 at 31,603,312 bp
  • T to C, chromosome 17 at 58,974,546 bp
  • T to C, chromosome 17 at 66,377,988 bp
  • G to T, chromosome 18 at 20,456,908 bp
  • A to T, chromosome 18 at 33,802,507 bp
  • T to C, chromosome 18 at 67,512,865 bp
  • A to G, chromosome 19 at 9,004,681 bp
  • G to A, chromosome 19 at 42,607,613 bp
  • T to C, chromosome X at 7,166,352 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4700 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041948-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.