Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4700Btlr/Mmmh
Stock Number:
041948-MU
Citation ID:
RRID:MMRRC_041948-MU
Other Names:
R4700 (G1), C57BL/6J-MtgxR4700Btlr
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 17,091,704 bp
  • A to G, chromosome 1 at 66,410,637 bp
  • A to G, chromosome 1 at 74,570,272 bp
  • A to T, chromosome 1 at 75,503,441 bp
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • A to G, chromosome 1 at 139,198,771 bp
  • A to G, chromosome 1 at 181,166,243 bp
  • A to T, chromosome 2 at 22,673,970 bp
  • G to T, chromosome 2 at 32,587,160 bp
  • C to A, chromosome 2 at 36,997,503 bp
  • C to A, chromosome 2 at 82,987,029 bp
  • G to T, chromosome 2 at 93,199,900 bp
  • A to G, chromosome 2 at 112,071,752 bp
  • C to G, chromosome 2 at 154,564,022 bp
  • C to A, chromosome 3 at 10,335,299 bp
  • T to G, chromosome 3 at 10,335,300 bp
  • A to T, chromosome 3 at 59,320,330 bp
  • C to T, chromosome 3 at 83,899,212 bp
  • T to C, chromosome 3 at 108,397,231 bp
  • T to C, chromosome 4 at 41,118,944 bp
  • T to A, chromosome 4 at 47,033,127 bp
  • A to T, chromosome 4 at 48,636,869 bp
  • T to C, chromosome 4 at 58,097,323 bp
  • A to T, chromosome 4 at 111,890,937 bp
  • C to T, chromosome 4 at 117,960,035 bp
  • T to C, chromosome 4 at 145,303,122 bp
  • G to T, chromosome 5 at 34,217,845 bp
  • T to C, chromosome 5 at 73,065,538 bp
  • A to T, chromosome 5 at 87,092,442 bp
  • T to C, chromosome 5 at 106,973,841 bp
  • T to C, chromosome 5 at 111,277,043 bp
  • T to C, chromosome 5 at 138,296,783 bp
  • A to T, chromosome 6 at 57,926,205 bp
  • T to C, chromosome 6 at 67,473,850 bp
  • C to T, chromosome 6 at 115,862,721 bp
  • C to A, chromosome 6 at 115,958,615 bp
  • C to T, chromosome 6 at 116,626,883 bp
  • A to C, chromosome 7 at 5,146,587 bp
  • G to T, chromosome 7 at 5,146,588 bp
  • A to G, chromosome 7 at 25,363,515 bp
  • T to A, chromosome 7 at 28,386,927 bp
  • T to C, chromosome 7 at 31,619,483 bp
  • A to G, chromosome 7 at 35,438,437 bp
  • T to C, chromosome 7 at 67,041,888 bp
  • A to T, chromosome 7 at 105,056,276 bp
  • T to C, chromosome 7 at 109,921,198 bp
  • T to A, chromosome 7 at 120,312,705 bp
  • T to C, chromosome 7 at 141,442,249 bp
  • G to T, chromosome 8 at 13,039,621 bp
  • A to T, chromosome 8 at 22,000,121 bp
  • T to A, chromosome 8 at 87,781,710 bp
  • T to A, chromosome 8 at 125,028,794 bp
  • A to G, chromosome 9 at 16,031,173 bp
  • A to G, chromosome 9 at 21,587,184 bp
  • A to G, chromosome 9 at 21,927,731 bp
  • T to C, chromosome 9 at 27,015,215 bp
  • A to T, chromosome 9 at 35,789,725 bp
  • A to G, chromosome 9 at 37,918,921 bp
  • A to G, chromosome 9 at 44,173,380 bp
  • A to G, chromosome 9 at 67,346,527 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to C, chromosome 9 at 87,206,862 bp
  • C to T, chromosome 9 at 106,433,583 bp
  • T to A, chromosome 9 at 106,653,931 bp
  • T to C, chromosome 9 at 106,754,025 bp
  • A to G, chromosome 10 at 56,224,649 bp
  • A to G, chromosome 10 at 88,730,637 bp
  • A to G, chromosome 10 at 91,096,152 bp
  • A to G, chromosome 10 at 109,764,935 bp
  • A to G, chromosome 10 at 116,777,342 bp
  • T to C, chromosome 10 at 118,868,286 bp
  • T to C, chromosome 11 at 3,712,160 bp
  • T to C, chromosome 11 at 6,516,785 bp
  • A to G, chromosome 11 at 9,292,306 bp
  • A to G, chromosome 11 at 21,711,719 bp
  • C to A, chromosome 11 at 49,626,444 bp
  • C to T, chromosome 11 at 50,237,081 bp
  • T to C, chromosome 11 at 62,847,788 bp
  • A to T, chromosome 11 at 73,251,284 bp
  • T to C, chromosome 11 at 83,121,649 bp
  • T to C, chromosome 11 at 84,916,329 bp
  • A to C, chromosome 11 at 110,070,482 bp
  • A to T, chromosome 11 at 115,861,935 bp
  • G to A, chromosome 11 at 116,135,152 bp
  • A to G, chromosome 12 at 8,790,541 bp
  • T to C, chromosome 12 at 85,476,162 bp
  • T to A, chromosome 13 at 3,933,514 bp
  • A to G, chromosome 13 at 31,558,812 bp
  • T to C, chromosome 13 at 67,786,617 bp
  • A to G, chromosome 13 at 100,223,414 bp
  • T to C, chromosome 13 at 112,613,735 bp
  • T to C, chromosome 13 at 119,949,842 bp
  • T to A, chromosome 14 at 14,842,841 bp
  • T to C, chromosome 14 at 16,281,809 bp
  • C to A, chromosome 14 at 26,925,971 bp
  • G to A, chromosome 14 at 51,457,485 bp
  • A to G, chromosome 14 at 54,988,321 bp
  • A to T, chromosome 14 at 65,979,864 bp
  • T to C, chromosome 15 at 7,237,776 bp
  • C to T, chromosome 15 at 39,086,708 bp
  • T to A, chromosome 15 at 65,881,505 bp
  • C to T, chromosome 15 at 76,708,585 bp
  • T to A, chromosome 15 at 80,257,417 bp
  • A to T, chromosome 15 at 94,394,622 bp
  • A to T, chromosome 16 at 15,702,112 bp
  • A to G, chromosome 16 at 30,565,449 bp
  • G to T, chromosome 16 at 34,922,435 bp
  • A to G, chromosome 16 at 35,279,216 bp
  • A to G, chromosome 16 at 57,570,695 bp
  • A to G, chromosome 16 at 94,439,241 bp
  • G to A, chromosome 17 at 7,771,480 bp
  • T to C, chromosome 17 at 21,722,407 bp
  • C to T, chromosome 17 at 31,603,312 bp
  • T to C, chromosome 17 at 58,974,546 bp
  • T to C, chromosome 17 at 66,377,988 bp
  • G to T, chromosome 18 at 20,456,908 bp
  • A to T, chromosome 18 at 33,802,507 bp
  • T to C, chromosome 18 at 67,512,865 bp
  • A to G, chromosome 19 at 9,004,681 bp
  • G to A, chromosome 19 at 42,607,613 bp
  • T to C, chromosome X at 7,166,352 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4700 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041948-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.