Loading Mouse GIF
Loading...

Strain Name:
FVB/NJ-Tg(Myh6-tTA)55Rbns/Mmmh
Stock Number:
042280-MU
Citation ID:
RRID:MMRRC_042280-MU
Other Names:
Tg(Myh6-tTA)55Rbns, alpha-MHC-tTA

Strain Information

Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Tg(Myh6-tTA)55Rbns
Name: transgene insertion 55, Jeffrey Robbins
Synonyms: alpha-MHC-tTA
Type: Transgene
Species: Mus musculus (mouse)
Chromosome: UN
Alteration at locus: Transgenic
Genetic Alterations
This transgene consists of the tetracycline transactivator (a chimeric tTA fusion protein of the Tn10 Tet resistance operon in E.coli and the carboxy-terminal portion of the transactivator protein from herpes simplex virus -VP16) under the control of the cardiac specific mouse alpha myosin heavy chain. Although transgene protein expression is not detected in the heart via Western blot, when transgenics are crossed with Tg(tetop-lacZ)2Mam, uniform and robust expression of lacZ is seen in the hearts, indicating that very low levels of tTA protein are present to induce lacZ expression.
Genotype Determination
Phenotype

Homozygous: Same as Wild-type

Hemizygous: Same as Wild-type

Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Cardiovascular
  • Research Tools
Donor
Jeffrey Robbins, Ph.D., Cincinnati Children's Hospital.
Strain Development

The tTa construct was inserted into the α-MHC promoter cassette. A responder minimal promoter that was copy number dependent and chromosomal integration site independent was derived from the mouse α-MHC sequences. Two thyroid response elements (TREs) at positions 4217 to 4240 (TRE1) and 4251 to 4267 (TRE2)25,26 and 3 GATA sites at positions 2455,27 4106, and 411428 were destroyed to create the basal promoter. To provide a binding site for the transactivator, an ≈300-bp fragment consisting of 7 repeats of the sequence TCGAGTTTACCACTCCCTA TCAGTGATAGAGAAAAGTGAAAG was inserted after base 4281, 57 bp upstream from the TATA element (Figure 3A). The ELC atrial isoform (ELC1a) or a constitutively active form of mouse glycogen synthase kinase-3β (GSK-3β) was linked to the responder promoter to determine its ability to drive high levels of TG protein expression on induction. The human growth hormone polyadenylation site (hGH polyA) was placed downstream from all cDNAs. All constructs were digested free of the vector sequence with NotI, purified from agarose, and used to generate transgenic mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
White
MMRRC Breeding System
Other or uncertain
Generation
Unknown
Overall Breeding Performance
Excellent
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: 8 to 12 months Undetermined
Average litter size
10-14
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

TET-System Technology (tetracycline; US 5,814,618; 5,859,310; 7,541,446; 8,383,364 and European Patent EP 0804565)

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042280-MU-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
042280-MU-RESUS Litter recovered from cryo-archive $2,697.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.