Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4794Btlr/Mmmh
Stock Number:
042420-MU
Citation ID:
RRID:MMRRC_042420-MU
Other Names:
R4794 (G1), C57BL/6J-MtgxR4794Btlr
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Sf1
Name: splicing factor 1
Synonyms: WBP4, MZFM, CW17R, Zfp162
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22668
Homologene: 134065
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Slc17a5
Name: solute carrier family 17 (anion/sugar transporter), member 5
Synonyms: 4631416G20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235504
Homologene: 56571
Mbd4
Name: methyl-CpG binding domain protein 4
Synonyms: Med1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17193
HGNC: HGNC:6919
Homologene: 2916
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,029,160 bp
  • T to C, chromosome 1 at 93,025,727 bp
  • A to T, chromosome 1 at 150,454,546 bp
  • T to A, chromosome 1 at 172,119,321 bp
  • T to C, chromosome 1 at 182,973,896 bp
  • G to A, chromosome 2 at 28,661,690 bp
  • A to T, chromosome 2 at 59,862,844 bp
  • A to T, chromosome 2 at 60,272,149 bp
  • A to T, chromosome 2 at 88,446,347 bp
  • A to G, chromosome 2 at 130,041,955 bp
  • G to A, chromosome 2 at 155,623,266 bp
  • A to T, chromosome 2 at 156,095,569 bp
  • G to C, chromosome 2 at 158,196,139 bp
  • A to T, chromosome 3 at 33,803,149 bp
  • A to G, chromosome 3 at 90,490,785 bp
  • T to A, chromosome 3 at 95,490,269 bp
  • A to T, chromosome 3 at 116,645,506 bp
  • G to A, chromosome 3 at 132,686,968 bp
  • ACTTCTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTCTTC, chromosome 4 at 56,781,176 bp
  • C to A, chromosome 4 at 106,654,210 bp
  • A to G, chromosome 4 at 107,390,222 bp
  • A to G, chromosome 4 at 141,071,601 bp
  • T to A, chromosome 4 at 156,249,465 bp
  • T to C, chromosome 5 at 22,344,185 bp
  • C to T, chromosome 5 at 24,415,897 bp
  • A to G, chromosome 5 at 29,597,085 bp
  • G to A, chromosome 5 at 98,966,633 bp
  • A to G, chromosome 5 at 101,943,943 bp
  • A to G, chromosome 6 at 3,475,933 bp
  • A to G, chromosome 6 at 28,430,596 bp
  • G to A, chromosome 6 at 38,194,485 bp
  • G to A, chromosome 6 at 39,117,810 bp
  • T to A, chromosome 6 at 43,235,695 bp
  • A to G, chromosome 6 at 115,844,595 bp
  • T to C, chromosome 6 at 116,258,649 bp
  • T to C, chromosome 6 at 124,914,924 bp
  • G to A, chromosome 6 at 125,358,084 bp
  • G to T, chromosome 6 at 126,885,337 bp
  • A to G, chromosome 6 at 141,767,562 bp
  • C to T, chromosome 7 at 4,943,745 bp
  • C to A, chromosome 7 at 33,365,726 bp
  • C to T, chromosome 7 at 100,503,992 bp
  • A to C, chromosome 7 at 117,637,635 bp
  • A to T, chromosome 8 at 57,545,363 bp
  • G to A, chromosome 8 at 83,999,717 bp
  • G to A, chromosome 8 at 111,720,920 bp
  • C to T, chromosome 9 at 19,375,545 bp
  • T to A, chromosome 9 at 78,574,715 bp
  • A to G, chromosome 10 at 11,390,853 bp
  • A to G, chromosome 10 at 21,145,308 bp
  • A to G, chromosome 10 at 23,900,704 bp
  • A to G, chromosome 10 at 56,196,836 bp
  • G to T, chromosome 10 at 79,900,117 bp
  • G to T, chromosome 10 at 115,182,770 bp
  • T to C, chromosome 11 at 85,509,468 bp
  • T to A, chromosome 11 at 102,870,177 bp
  • A to G, chromosome 11 at 120,811,295 bp
  • G to A, chromosome 12 at 16,940,407 bp
  • T to C, chromosome 12 at 51,650,171 bp
  • A to T, chromosome 12 at 81,421,424 bp
  • A to G, chromosome 13 at 43,414,076 bp
  • C to G, chromosome 13 at 50,703,239 bp
  • T to C, chromosome 14 at 34,822,622 bp
  • T to C, chromosome 14 at 49,048,900 bp
  • A to G, chromosome 15 at 74,588,129 bp
  • T to A, chromosome 15 at 91,841,454 bp
  • T to A, chromosome 15 at 99,057,427 bp
  • C to T, chromosome 16 at 33,989,810 bp
  • A to G, chromosome 17 at 6,620,355 bp
  • A to G, chromosome 17 at 37,010,130 bp
  • A to T, chromosome 17 at 46,930,445 bp
  • C to A, chromosome 18 at 9,848,984 bp
  • T to C, chromosome 19 at 5,756,679 bp
  • C to A, chromosome 19 at 6,375,664 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4794 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042420-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.