Strain Name:
C57BL/6J-MtgxR4794Btlr/Mmmh
Stock Number:
042420-MU
Citation ID:
RRID:MMRRC_042420-MU
Other Names:
R4794 (G1), C57BL/6J-MtgxR4794Btlr
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Sf1
Name: splicing factor 1
Synonyms: Zfp162, CW17R, MZFM, WBP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22668
Homologene: 134065
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330286
Homologene: 19782
Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Slc17a5
Name: solute carrier family 17 (anion/sugar transporter), member 5
Synonyms: 4631416G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235504
Homologene: 56571
Mbd4
Name: methyl-CpG binding domain protein 4
Synonyms: Med1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17193
HGNC: HGNC:6919
Homologene: 2916
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Bwf1, 2610509D04Rik, Ggtb3, Bchs, Alfy, D5Ertd66e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72145
Homologene: 22855
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rho-kinase, Rock-II, ROKalpha, Rock2m, B230113H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Washc2
Name: WASH complex subunit 2
Synonyms: D6Wsu116e, Fam21, C530005J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 28006
Homologene: 41686
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100763
Homologene: 8783
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Exoc5
Name: exocyst complex component 5
Synonyms: SEC10, PRO1912, Sec10l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105504
Homologene: 38195
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: Snrp116, 116kDa, U5-116kD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20624
Homologene: 3133
Bcas3
Name: BCAS3 microtubule associated cell migration factor
Synonyms: 1500019F07Rik, 2610028P08Rik, Phaf2, K20D4, rudhira, breast carcinoma amplified sequence 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192197
Homologene: 9778
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Ndc1
Name: NDC1 transmembrane nucleoporin
Synonyms: 2810475A17Rik, Tmem48, sks
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72787
Homologene: 41224
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Tbck
Name: TBC1 domain containing kinase
Synonyms: A630047E20Rik, C030007I09Rik, 1700120J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 271981
Homologene: 13221
Elp1
Name: elongator complex protein 1
Synonyms: C78473, IKAP, 3110040G09Rik, Ikbkap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Bcar1
Name: breast cancer anti-estrogen resistance 1
Synonyms: Cas, Crkas, p130Cas
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12927
HGNC: HGNC:971
Homologene: 7674
Tph2
Name: tryptophan hydroxylase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216343
Homologene: 27831
Hepacam2
Name: HEPACAM family member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101202
Homologene: 18724
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: D3Ertd557e, ESTM42, bHLHe2, Hif1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Zfp57
Name: zinc finger protein 57
Synonyms: G19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22715
Homologene: 7603
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68187
Homologene: 32665
Tsc1
Name: TSC complex subunit 1
Synonyms: tuberous sclerosis 1, hamartin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64930
Homologene: 314
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: C6orf170, Bromi, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, E530005C20Rik, 2210407G14Rik, Hapip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Mfsd14a
Name: major facilitator superfamily domain containing 14A
Synonyms: Hiat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15247
Homologene: 22456
Colec12
Name: collectin sub-family member 12
Synonyms: CL-P1, Scara4, SRCL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 140792
VEGA: 18
Homologene: 34248
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21818
Homologene: 20690
Tnfrsf1a
Name: tumor necrosis factor receptor superfamily, member 1a
Synonyms: TNFAR, CD120a, TNF-R1, TNF receptor alpha chain, TNFalpha-R1, TNF-R55, TNFRI, TNF-alpha-R1, TNF-alphaR1, TNFRp55, Tnfr1, p55, p55-R, TNF-R-I, TNFR60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21937
Homologene: 828
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Prkg2
Name: protein kinase, cGMP-dependent, type II
Synonyms: cGK-II, Prkgr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19092
HGNC: HGNC:9416
Homologene: 4556
Vnn1
Name: vanin 1
Synonyms: pantetheinase, V-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22361
Homologene: 32130
Asic3
Name: acid-sensing (proton-gated) ion channel 3
Synonyms: Accn3, DRASIC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 171209
HGNC: HGNC:101
Homologene: 20999
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
Xylt1
Name: xylosyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233781
Homologene: 32534
Kif1a
Name: kinesin family member 1A
Synonyms: ATSV, Kns1, LOC381283, N-3 kinesin, C630002N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: SZP, DOL54, MSF, lubricin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Smgc
Name: submandibular gland protein C
Synonyms: 2310010P21Rik, DXImx49e, Sfc21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223809
Ssc5d
Name: scavenger receptor cysteine rich family, 5 domains
Synonyms: s5d-srcrb, A430110N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269855
Homologene: 77555
D630003M21Rik
Name: RIKEN cDNA D630003M21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228846
Homologene: 18598
Wdsub1
Name: WD repeat, SAM and U-box domain containing 1
Synonyms: 2610014F08Rik, 1700048E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72137
Homologene: 17609
Med16
Name: mediator complex subunit 16
Synonyms: Trap95, Thrap5, 95kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216154
Homologene: 64602
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: Bai1, B830018M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: 4933402I15Rik, 4931403I22Rik, 2700016E08Rik, 4930434D01Rik, cI-44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67120
Homologene: 12085
Rbm12
Name: RNA binding motif protein 12
Synonyms: SWAN, 9430070C08Rik, 5730420G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Dnajb13
Name: DnaJ heat shock protein family (Hsp40) member B13
Synonyms: 1700014P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69387
Homologene: 70141
Gm8765
Name: predicted gene 8765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 667693
Homologene: 134512
Galnt7
Name: polypeptide N-acetylgalactosaminyltransferase 7
Synonyms: ppGaNTase-T7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 108150
HGNC: HGNC:4129
Homologene: 9685
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53791
Homologene: 20698
Snapin
Name: SNAP-associated protein
Synonyms: Bloc1s7, Snapap, Snap25bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20615
Homologene: 8251
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 11498
Homologene: 86950
Parp12
Name: poly (ADP-ribose) polymerase family, member 12
Synonyms: Zc3hdc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243771
Homologene: 11236
Dyrk4
Name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Synonyms: Dyrk4b, Dyrk4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Gm5724
Name: predicted gene 5724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 435927
Samd1
Name: sterile alpha motif domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 666704
Homologene: 124206
Ptms
Name: parathymosin
Synonyms: 2610009E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69202
HGNC: HGNC:9629
Or2a57
Name: olfactory receptor family 2 subfamily A member 57
Synonyms: GA_x6K02T2P3E9-4322325-4321360, IB12, MOR261-9, Olfr47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18346
Homologene: 133700
Or7g29
Name: olfactory receptor family 7 subfamily G member 29
Synonyms: GA_x6K02T2PVTD-13113073-13112135, MOR149-2, Olfr847
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258518
HGNC: HGNC:8466
Homologene: 17281
Pars2
Name: prolyl-tRNA synthetase (mitochondrial)(putative)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230577
Homologene: 5830
Epm2a
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: laforin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13853
HGNC: HGNC:3413
Homologene: 38087
Fscn3
Name: fascin actin-bundling protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56223
HGNC: HGNC:3961
Homologene: 10475
Samd11
Name: sterile alpha motif domain containing 11
Synonyms: mr-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 231004
VEGA: 4
Homologene: 34983
Cd302
Name: CD302 antigen
Synonyms: 1110055L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66205
Homologene: 8919
Tmem181c-ps
Name: transmembrane protein 181C, pseudogene
Synonyms: Tmem181d-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100040525
Gm26577
Name: predicted gene, 26577
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Gm13757
Name: predicted gene 13757
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Necap2
Name: NECAP endocytosis associated 2
Synonyms: 1110005F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66147
Homologene: 9168
Scgb2b20
Name: secretoglobin, family 2B, member 20
Synonyms: C2c, Abpd, Abpbg20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 494519
Homologene: 83171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,029,160 bp
  • T to C, chromosome 1 at 93,025,727 bp
  • A to T, chromosome 1 at 150,454,546 bp
  • T to A, chromosome 1 at 172,119,321 bp
  • T to C, chromosome 1 at 182,973,896 bp
  • G to A, chromosome 2 at 28,661,690 bp
  • A to T, chromosome 2 at 59,862,844 bp
  • A to T, chromosome 2 at 60,272,149 bp
  • A to T, chromosome 2 at 88,446,347 bp
  • A to G, chromosome 2 at 130,041,955 bp
  • G to A, chromosome 2 at 155,623,266 bp
  • A to T, chromosome 2 at 156,095,569 bp
  • G to C, chromosome 2 at 158,196,139 bp
  • A to T, chromosome 3 at 33,803,149 bp
  • A to G, chromosome 3 at 90,490,785 bp
  • T to A, chromosome 3 at 95,490,269 bp
  • A to T, chromosome 3 at 116,645,506 bp
  • G to A, chromosome 3 at 132,686,968 bp
  • ACTTCTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTCTTC, chromosome 4 at 56,781,176 bp
  • C to A, chromosome 4 at 106,654,210 bp
  • A to G, chromosome 4 at 107,390,222 bp
  • A to G, chromosome 4 at 141,071,601 bp
  • T to A, chromosome 4 at 156,249,465 bp
  • T to C, chromosome 5 at 22,344,185 bp
  • C to T, chromosome 5 at 24,415,897 bp
  • A to G, chromosome 5 at 29,597,085 bp
  • G to A, chromosome 5 at 98,966,633 bp
  • A to G, chromosome 5 at 101,943,943 bp
  • A to G, chromosome 6 at 3,475,933 bp
  • A to G, chromosome 6 at 28,430,596 bp
  • G to A, chromosome 6 at 38,194,485 bp
  • G to A, chromosome 6 at 39,117,810 bp
  • T to A, chromosome 6 at 43,235,695 bp
  • A to G, chromosome 6 at 115,844,595 bp
  • T to C, chromosome 6 at 116,258,649 bp
  • T to C, chromosome 6 at 124,914,924 bp
  • G to A, chromosome 6 at 125,358,084 bp
  • G to T, chromosome 6 at 126,885,337 bp
  • A to G, chromosome 6 at 141,767,562 bp
  • C to T, chromosome 7 at 4,943,745 bp
  • C to A, chromosome 7 at 33,365,726 bp
  • C to T, chromosome 7 at 100,503,992 bp
  • A to C, chromosome 7 at 117,637,635 bp
  • A to T, chromosome 8 at 57,545,363 bp
  • G to A, chromosome 8 at 83,999,717 bp
  • G to A, chromosome 8 at 111,720,920 bp
  • C to T, chromosome 9 at 19,375,545 bp
  • T to A, chromosome 9 at 78,574,715 bp
  • A to G, chromosome 10 at 11,390,853 bp
  • A to G, chromosome 10 at 21,145,308 bp
  • A to G, chromosome 10 at 23,900,704 bp
  • A to G, chromosome 10 at 56,196,836 bp
  • G to T, chromosome 10 at 79,900,117 bp
  • G to T, chromosome 10 at 115,182,770 bp
  • T to C, chromosome 11 at 85,509,468 bp
  • T to A, chromosome 11 at 102,870,177 bp
  • A to G, chromosome 11 at 120,811,295 bp
  • G to A, chromosome 12 at 16,940,407 bp
  • T to C, chromosome 12 at 51,650,171 bp
  • A to T, chromosome 12 at 81,421,424 bp
  • A to G, chromosome 13 at 43,414,076 bp
  • C to G, chromosome 13 at 50,703,239 bp
  • T to C, chromosome 14 at 34,822,622 bp
  • T to C, chromosome 14 at 49,048,900 bp
  • A to G, chromosome 15 at 74,588,129 bp
  • T to A, chromosome 15 at 91,841,454 bp
  • T to A, chromosome 15 at 99,057,427 bp
  • C to T, chromosome 16 at 33,989,810 bp
  • A to G, chromosome 17 at 6,620,355 bp
  • A to G, chromosome 17 at 37,010,130 bp
  • A to T, chromosome 17 at 46,930,445 bp
  • C to A, chromosome 18 at 9,848,984 bp
  • T to C, chromosome 19 at 5,756,679 bp
  • C to A, chromosome 19 at 6,375,664 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4794 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042420-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.