Strain Name:
C57BL/6J-MtgxR4836Btlr/Mmmh
Stock Number:
042451-MU
Citation ID:
RRID:MMRRC_042451-MU
Other Names:
R4836 (G1), C57BL/6J-MtgxR4836Btlr
Major Collection:

Gene Information

Dnm2
Name: dynamin 2
Synonyms: Dyn2, b2b2159Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13430
HGNC: HGNC:2974
Homologene: 90883
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108829
Homologene: 3129
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Rb-Bp2, Plu1, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Dnmt1
Name: DNA methyltransferase (cytosine-5) 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Kdm5a
Name: lysine (K)-specific demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Sulf1
Name: sulfatase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240725
Homologene: 49408
Cog5
Name: component of oligomeric golgi complex 5
Synonyms: GOLTC1, GTC90, 5430405C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238123
VEGA: 12
Homologene: 42221
Ccnt1
Name: cyclin T1
Synonyms: CycT1, 2810478G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12455
HGNC: HGNC:1599
Homologene: 947
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Pcp-1, Itpr-1, Ip3r, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74081
Homologene: 8879
Cct4
Name: chaperonin containing Tcp1, subunit 4 (delta)
Synonyms: A45, TCP-1 delta, T complex protein 1, delta, Cctd, 2610204B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12464
HGNC: HGNC:1617
Homologene: 4695
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433804
Homologene: 133076
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Mmp20
Name: matrix metallopeptidase 20 (enamelysin)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 30800
VEGA: 9
HGNC: HGNC:7167
Homologene: 21001
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 209456
Homologene: 3959
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, TSP-1, Thbs-1, tbsp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 21825
Homologene: 31142
Stmn1
Name: stathmin 1
Synonyms: leukemia associated phosphoprotein p18, prosolin, Lap18, op18, p18, p19, 19K, SMN, PR22, PP18, PP17, Lag, oncoprotein18, pig, metablastin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16765
HGNC: HGNC:6510
Homologene: 4063
Ramp3
Name: receptor (calcitonin) activity modifying protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56089
HGNC: HGNC:9845
Homologene: 4276
Mcpt1
Name: mast cell protease 1
Synonyms: Mcp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 17224
VEGA: 14
Homologene: 137209
Jak1
Name: Janus kinase 1
Synonyms: C130039L05Rik, BAP004
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16451
HGNC: HGNC:6190
Homologene: 1678
Zfp65
Name: zinc finger protein 65
Synonyms: KRAB5, Zfp71-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 235907
Homologene: 87875
Txnl4a
Name: thioredoxin-like 4A
Synonyms: U5-15kDa, D18Wsu98e, Txnl4, ENSMUSG00000057130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 27366
Homologene: 7150
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72333
Homologene: 75052
Rrbp1
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 5730465C04Rik, 1700087N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 81910
Homologene: 68138
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 654470
Homologene: 49770
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Mov10l1
Name: Mov10 like RISC complex RNA helicase 1
Synonyms: CHAMP, Csm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 83456
HGNC: HGNC:7201
Homologene: 56835
Isl1
Name: ISL1 transcription factor, LIM/homeodomain
Synonyms: Islet 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16392
HGNC: HGNC:6132
Homologene: 1661
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, Clc1, NMF355, nmf355
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Tespa1
Name: thymocyte expressed, positive selection associated 1
Synonyms: A430001F24Rik, 5830405N20Rik, Itprid3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67596
VEGA: 10
Homologene: 106645
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22249
Homologene: 31376
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Gm1965
Name: predicted gene 1965
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 434065
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244234
Homologene: 133218
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Arhgef15
Name: Rho guanine nucleotide exchange factor (GEF) 15
Synonyms: D530030K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 442801
Homologene: 18345
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Tmem208
Name: transmembrane protein 208
Synonyms: 2610030K20Rik, 1700006C06Rik, Hspc171
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66320
Homologene: 40930
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94229
Homologene: 23340
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 333315
Homologene: 35388
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338349
Homologene: 9805
Dpep1
Name: dipeptidase 1
Synonyms: MBD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13479
HGNC: HGNC:3002
Homologene: 80192
Olfr1196
Name: olfactory receptor 1196
Synonyms: GA_x6K02T2Q125-50181139-50180195, MOR225-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258456
Homologene: 123770
Lexm
Name: lymphocyte expansion molecule
Synonyms: BC055111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242602
Homologene: 17630
D6Ertd527e
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52372
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99681
Homologene: 136273
Rusf1
Name: RUS family member 1
Synonyms: BC017158
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233913
Homologene: 11232
Bend6
Name: BEN domain containing 6
Synonyms: B230209C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320705
Homologene: 27394
Ankrd53
Name: ankyrin repeat domain 53
Synonyms: 4930564N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75305
Homologene: 49810
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232801
Homologene: 83297
Olfr1054
Name: olfactory receptor 1054
Synonyms: GA_x6K02T2Q125-47811880-47810942, MOR188-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259021
Homologene: 133882
Olfr1056
Name: olfactory receptor 1056
Synonyms: GA_x6K02T2Q125-47827833-47826892, MOR186-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259020
Homologene: 27328
Acox1
Name: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: Acyl-CoA oxidase, AOX, D130055E20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11430
HGNC: HGNC:119
Homologene: 38299
AF366264
Name: cDNA sequence AF366264
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 231201
Homologene: 130042
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Olfr533
Name: olfactory receptor 533
Synonyms: GA_x6K02T2PBJ9-42615403-42616365, MOR252-3P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258056
Homologene: 128384
Phf11a
Name: PHD finger protein 11A
Synonyms: 4933417L10Rik, Phf11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219131
Homologene: 87807
Olfr1009
Name: olfactory receptor 1009
Synonyms: GA_x6K02T2Q125-47195323-47196267, MOR175-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258565
Homologene: 17297
Smoc1
Name: SPARC related modular calcium binding 1
Synonyms: SPARC-related protein, SRG, 2600002F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 64075
Homologene: 56943
Surf1
Name: surfeit gene 1
Synonyms: Surf-1, 0610010F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20930
Homologene: 2387
Vmn1r188
Name: vomeronasal 1 receptor 188
Synonyms: V1rh17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 252912
Homologene: 110880
Tdrkh
Name: tudor and KH domain containing protein
Synonyms: Tdrd2, 2700091C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72634
Homologene: 4999
Olfr330
Name: olfactory receptor 330
Synonyms: GA_x6K02T2NKPP-895420-896349, MOR275-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258879
Homologene: 133015
Naa80
Name: N(alpha)-acetyltransferase 80, NatH catalytic subunit
Synonyms: Nat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56441
Homologene: 36325
H1f9
Name: H1.9 linker histone
Synonyms: TISP64, Hils1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54388
Homologene: 56818
Eef2kmt
Name: eukaryotic elongation factor 2 lysine methyltransferase
Synonyms: 5730409G15Rik, Fam86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70511
Homologene: 45719
Gm6866
Name: predicted gene 6866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 628304
Homologene: 80005
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 12,842,686 bp
  • T to C, chromosome 1 at 33,883,573 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • C to A, chromosome 1 at 134,593,315 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • T to C, chromosome 1 at 155,928,833 bp
  • C to T, chromosome 1 at 182,431,582 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to C, chromosome 2 at 26,914,243 bp
  • T to A, chromosome 2 at 31,608,141 bp
  • A to G, chromosome 2 at 62,268,187 bp
  • A to G, chromosome 2 at 76,711,197 bp
  • A to G, chromosome 2 at 85,721,449 bp
  • A to T, chromosome 2 at 86,333,227 bp
  • G to A, chromosome 2 at 86,355,750 bp
  • A to G, chromosome 2 at 88,701,200 bp
  • A to G, chromosome 2 at 118,115,018 bp
  • G to A, chromosome 2 at 143,988,417 bp
  • A to T, chromosome 3 at 93,445,148 bp
  • A to T, chromosome 3 at 93,447,588 bp
  • T to A, chromosome 3 at 94,425,590 bp
  • T to G, chromosome 4 at 43,237,137 bp
  • T to A, chromosome 4 at 85,049,720 bp
  • T to C, chromosome 4 at 101,155,066 bp
  • T to A, chromosome 4 at 106,610,527 bp
  • T to A, chromosome 4 at 134,470,184 bp
  • T to A, chromosome 4 at 147,584,155 bp
  • A to T, chromosome 5 at 122,245,505 bp
  • G to T, chromosome 6 at 42,309,964 bp
  • A to T, chromosome 6 at 83,768,152 bp
  • GGCAGCAGCAGCA to GGCAGCAGCAGCAGCA, chromosome 6 at 87,111,424 bp
  • T to C, chromosome 6 at 89,145,410 bp
  • A to T, chromosome 6 at 108,389,537 bp
  • T to C, chromosome 6 at 120,412,402 bp
  • T to C, chromosome 7 at 4,238,714 bp
  • C to T, chromosome 7 at 27,309,374 bp
  • C to T, chromosome 7 at 41,215,534 bp
  • A to G, chromosome 7 at 128,267,505 bp
  • T to C, chromosome 7 at 140,299,108 bp
  • A to G, chromosome 7 at 140,467,076 bp
  • C to T, chromosome 8 at 13,838,007 bp
  • T to A, chromosome 8 at 61,687,381 bp
  • T to A, chromosome 8 at 80,663,397 bp
  • C to T, chromosome 8 at 105,328,664 bp
  • A to G, chromosome 8 at 123,200,367 bp
  • T to A, chromosome 9 at 7,644,026 bp
  • A to G, chromosome 9 at 16,377,723 bp
  • C to T, chromosome 9 at 20,908,558 bp
  • A to T, chromosome 9 at 21,491,330 bp
  • A to T, chromosome 9 at 107,583,539 bp
  • T to C, chromosome 10 at 67,233,446 bp
  • C to T, chromosome 10 at 130,362,159 bp
  • A to G, chromosome 11 at 6,674,761 bp
  • A to G, chromosome 11 at 23,002,898 bp
  • A to T, chromosome 11 at 53,650,653 bp
  • A to C, chromosome 11 at 58,529,482 bp
  • G to T, chromosome 11 at 67,096,939 bp
  • A to T, chromosome 11 at 68,949,925 bp
  • T to A, chromosome 11 at 94,968,017 bp
  • A to T, chromosome 11 at 116,175,326 bp
  • T to C, chromosome 12 at 31,919,733 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • T to A, chromosome 12 at 81,179,548 bp
  • T to C, chromosome 12 at 105,646,814 bp
  • A to T, chromosome 12 at 112,774,116 bp
  • A to C, chromosome 13 at 22,088,121 bp
  • A to G, chromosome 13 at 67,708,875 bp
  • A to G, chromosome 13 at 99,431,054 bp
  • A to G, chromosome 13 at 116,303,083 bp
  • A to T, chromosome 14 at 56,019,560 bp
  • A to G, chromosome 14 at 56,585,738 bp
  • A to T, chromosome 14 at 59,287,579 bp
  • C to T, chromosome 15 at 4,904,270 bp
  • G to C, chromosome 15 at 78,445,388 bp
  • A to T, chromosome 15 at 89,020,269 bp
  • C to A, chromosome 15 at 98,567,563 bp
  • C to T, chromosome 16 at 5,249,003 bp
  • A to T, chromosome 16 at 63,583,557 bp
  • A to G, chromosome 18 at 80,222,253 bp
  • C to T, chromosome 19 at 7,509,545 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4836 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042451-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.