Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4836Btlr/Mmmh
Stock Number:
042451-MU
Citation ID:
RRID:MMRRC_042451-MU
Other Names:
R4836 (G1), C57BL/6J-MtgxR4836Btlr
Major Collection:

Strain Information

Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 12,842,686 bp
  • T to C, chromosome 1 at 33,883,573 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • C to A, chromosome 1 at 134,593,315 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • T to C, chromosome 1 at 155,928,833 bp
  • C to T, chromosome 1 at 182,431,582 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to C, chromosome 2 at 26,914,243 bp
  • T to A, chromosome 2 at 31,608,141 bp
  • A to G, chromosome 2 at 62,268,187 bp
  • A to G, chromosome 2 at 76,711,197 bp
  • A to G, chromosome 2 at 85,721,449 bp
  • A to T, chromosome 2 at 86,333,227 bp
  • G to A, chromosome 2 at 86,355,750 bp
  • A to G, chromosome 2 at 88,701,200 bp
  • A to G, chromosome 2 at 118,115,018 bp
  • G to A, chromosome 2 at 143,988,417 bp
  • A to T, chromosome 3 at 93,445,148 bp
  • A to T, chromosome 3 at 93,447,588 bp
  • T to A, chromosome 3 at 94,425,590 bp
  • T to G, chromosome 4 at 43,237,137 bp
  • T to A, chromosome 4 at 85,049,720 bp
  • T to C, chromosome 4 at 101,155,066 bp
  • T to A, chromosome 4 at 106,610,527 bp
  • T to A, chromosome 4 at 134,470,184 bp
  • T to A, chromosome 4 at 147,584,155 bp
  • A to T, chromosome 5 at 122,245,505 bp
  • G to T, chromosome 6 at 42,309,964 bp
  • A to T, chromosome 6 at 83,768,152 bp
  • GGCAGCAGCAGCA to GGCAGCAGCAGCAGCA, chromosome 6 at 87,111,424 bp
  • T to C, chromosome 6 at 89,145,410 bp
  • A to T, chromosome 6 at 108,389,537 bp
  • T to C, chromosome 6 at 120,412,402 bp
  • T to C, chromosome 7 at 4,238,714 bp
  • C to T, chromosome 7 at 27,309,374 bp
  • C to T, chromosome 7 at 41,215,534 bp
  • A to G, chromosome 7 at 128,267,505 bp
  • T to C, chromosome 7 at 140,299,108 bp
  • A to G, chromosome 7 at 140,467,076 bp
  • C to T, chromosome 8 at 13,838,007 bp
  • T to A, chromosome 8 at 61,687,381 bp
  • T to A, chromosome 8 at 80,663,397 bp
  • C to T, chromosome 8 at 105,328,664 bp
  • A to G, chromosome 8 at 123,200,367 bp
  • T to A, chromosome 9 at 7,644,026 bp
  • A to G, chromosome 9 at 16,377,723 bp
  • C to T, chromosome 9 at 20,908,558 bp
  • A to T, chromosome 9 at 21,491,330 bp
  • A to T, chromosome 9 at 107,583,539 bp
  • T to C, chromosome 10 at 67,233,446 bp
  • C to T, chromosome 10 at 130,362,159 bp
  • A to G, chromosome 11 at 6,674,761 bp
  • A to G, chromosome 11 at 23,002,898 bp
  • A to T, chromosome 11 at 53,650,653 bp
  • A to C, chromosome 11 at 58,529,482 bp
  • G to T, chromosome 11 at 67,096,939 bp
  • A to T, chromosome 11 at 68,949,925 bp
  • T to A, chromosome 11 at 94,968,017 bp
  • A to T, chromosome 11 at 116,175,326 bp
  • T to C, chromosome 12 at 31,919,733 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • T to A, chromosome 12 at 81,179,548 bp
  • T to C, chromosome 12 at 105,646,814 bp
  • A to T, chromosome 12 at 112,774,116 bp
  • A to C, chromosome 13 at 22,088,121 bp
  • A to G, chromosome 13 at 67,708,875 bp
  • A to G, chromosome 13 at 99,431,054 bp
  • A to G, chromosome 13 at 116,303,083 bp
  • A to T, chromosome 14 at 56,019,560 bp
  • A to G, chromosome 14 at 56,585,738 bp
  • A to T, chromosome 14 at 59,287,579 bp
  • C to T, chromosome 15 at 4,904,270 bp
  • G to C, chromosome 15 at 78,445,388 bp
  • A to T, chromosome 15 at 89,020,269 bp
  • C to A, chromosome 15 at 98,567,563 bp
  • C to T, chromosome 16 at 5,249,003 bp
  • A to T, chromosome 16 at 63,583,557 bp
  • A to G, chromosome 18 at 80,222,253 bp
  • C to T, chromosome 19 at 7,509,545 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4836 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042451-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.