Strain Name:
C57BL/6J-MtgxR4836Btlr/Mmmh
Stock Number:
042451-MU
Citation ID:
RRID:MMRRC_042451-MU
Other Names:
R4836 (G1), C57BL/6J-MtgxR4836Btlr
Major Collection:

Gene Information

Gene Symbol: Dnm2 [MGI:109547] (Mus musculus (mouse))
Name: dynamin 2
Synonyms: Dyn2, b2b2159Clo
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Jmjd1c [MGI:1918614] (Mus musculus (mouse))
Name: jumonji domain containing 1C
Synonyms: 5430433L24Rik, TRIP8, D630035I23Rik
Chromosome: 10
Alteration at locus: Chemically Induced
Gene Symbol: Kdm5b [MGI:1922855] (Mus musculus (mouse))
Name: lysine (K)-specific demethylase 5B
Synonyms: 2010009J12Rik, Plu1, Jarid1b, 2210016I17Rik, PLU-1, Rb-Bp2, D1Ertd202e
Chromosome: 1
Alteration at locus: Chemically Induced
Gene Symbol: Atl3 [MGI:1924270] (Mus musculus (mouse))
Name: atlastin GTPase 3
Synonyms: 5730596K20Rik, 4633402C03Rik
Chromosome: 19
Alteration at locus: Chemically Induced
Gene Symbol: Fubp3 [MGI:2443699] (Mus musculus (mouse))
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Dnmt1 [MGI:94912] (Mus musculus (mouse))
Name: DNA methyltransferase (cytosine-5) 1
Synonyms: Cxxc9, Dnmt1o, MTase, MommeD2
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Map1b [MGI:1306778] (Mus musculus (mouse))
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap1b, Mtap5, LC1
Chromosome: 13
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 12,842,686 bp
  • T to C, chromosome 1 at 33,883,573 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • C to A, chromosome 1 at 134,593,315 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • T to C, chromosome 1 at 155,928,833 bp
  • C to T, chromosome 1 at 182,431,582 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to C, chromosome 2 at 26,914,243 bp
  • T to A, chromosome 2 at 31,608,141 bp
  • A to G, chromosome 2 at 62,268,187 bp
  • A to G, chromosome 2 at 76,711,197 bp
  • A to G, chromosome 2 at 85,721,449 bp
  • A to T, chromosome 2 at 86,333,227 bp
  • G to A, chromosome 2 at 86,355,750 bp
  • A to G, chromosome 2 at 88,701,200 bp
  • A to G, chromosome 2 at 118,115,018 bp
  • G to A, chromosome 2 at 143,988,417 bp
  • A to T, chromosome 3 at 93,445,148 bp
  • A to T, chromosome 3 at 93,447,588 bp
  • T to A, chromosome 3 at 94,425,590 bp
  • T to G, chromosome 4 at 43,237,137 bp
  • T to A, chromosome 4 at 85,049,720 bp
  • T to C, chromosome 4 at 101,155,066 bp
  • T to A, chromosome 4 at 106,610,527 bp
  • T to A, chromosome 4 at 134,470,184 bp
  • T to A, chromosome 4 at 147,584,155 bp
  • A to T, chromosome 5 at 122,245,505 bp
  • G to T, chromosome 6 at 42,309,964 bp
  • A to T, chromosome 6 at 83,768,152 bp
  • GGCAGCAGCAGCA to GGCAGCAGCAGCAGCA, chromosome 6 at 87,111,424 bp
  • T to C, chromosome 6 at 89,145,410 bp
  • A to T, chromosome 6 at 108,389,537 bp
  • T to C, chromosome 6 at 120,412,402 bp
  • T to C, chromosome 7 at 4,238,714 bp
  • C to T, chromosome 7 at 27,309,374 bp
  • C to T, chromosome 7 at 41,215,534 bp
  • A to G, chromosome 7 at 128,267,505 bp
  • T to C, chromosome 7 at 140,299,108 bp
  • A to G, chromosome 7 at 140,467,076 bp
  • C to T, chromosome 8 at 13,838,007 bp
  • T to A, chromosome 8 at 61,687,381 bp
  • T to A, chromosome 8 at 80,663,397 bp
  • C to T, chromosome 8 at 105,328,664 bp
  • A to G, chromosome 8 at 123,200,367 bp
  • T to A, chromosome 9 at 7,644,026 bp
  • A to G, chromosome 9 at 16,377,723 bp
  • C to T, chromosome 9 at 20,908,558 bp
  • A to T, chromosome 9 at 21,491,330 bp
  • A to T, chromosome 9 at 107,583,539 bp
  • T to C, chromosome 10 at 67,233,446 bp
  • C to T, chromosome 10 at 130,362,159 bp
  • A to G, chromosome 11 at 6,674,761 bp
  • A to G, chromosome 11 at 23,002,898 bp
  • A to T, chromosome 11 at 53,650,653 bp
  • A to C, chromosome 11 at 58,529,482 bp
  • G to T, chromosome 11 at 67,096,939 bp
  • A to T, chromosome 11 at 68,949,925 bp
  • T to A, chromosome 11 at 94,968,017 bp
  • A to T, chromosome 11 at 116,175,326 bp
  • T to C, chromosome 12 at 31,919,733 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • T to A, chromosome 12 at 81,179,548 bp
  • T to C, chromosome 12 at 105,646,814 bp
  • A to T, chromosome 12 at 112,774,116 bp
  • A to C, chromosome 13 at 22,088,121 bp
  • A to G, chromosome 13 at 67,708,875 bp
  • A to G, chromosome 13 at 99,431,054 bp
  • A to G, chromosome 13 at 116,303,083 bp
  • A to T, chromosome 14 at 56,019,560 bp
  • A to G, chromosome 14 at 56,585,738 bp
  • A to T, chromosome 14 at 59,287,579 bp
  • C to T, chromosome 15 at 4,904,270 bp
  • G to C, chromosome 15 at 78,445,388 bp
  • A to T, chromosome 15 at 89,020,269 bp
  • C to A, chromosome 15 at 98,567,563 bp
  • C to T, chromosome 16 at 5,249,003 bp
  • A to T, chromosome 16 at 63,583,557 bp
  • A to G, chromosome 18 at 80,222,253 bp
  • C to T, chromosome 19 at 7,509,545 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4836 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042451-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.