Strain Name:
C57BL/6J-MtgxR4921Btlr/Mmmh
Stock Number:
042523-MU
Citation ID:
RRID:MMRRC_042523-MU
Other Names:
R4921 (G1), C57BL/6J-MtgxR4921Btlr
Major Collection:

Gene Information

Hmox1
Name: heme oxygenase 1
Synonyms: HO1, heme oxygenase 1, Hmox, D8Wsu38e, HO-1, Hsp32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: Cerp, PRCE, ESP1, separase, PRCE, SSE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105988
VEGA: 15
Homologene: 32151
Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 100502698
Homologene: 15687
Lcat
Name: lecithin cholesterol acyltransferase
Synonyms: D8Wsu61e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16816
HGNC: HGNC:6522
Homologene: 68042
Acvr2a
Name: activin receptor IIA
Synonyms: Acvr2, ActRIIa, tActRII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 11480
HGNC: HGNC:173
Homologene: 20391
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, mDomino, p400
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 75560
Homologene: 38779
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: BS4, NY-REN-18, 6330412F12Rik, 4931404D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 53312
Homologene: 41108
Slc25a12
Name: solute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms: B230107K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 78830
Homologene: 48235
Crct1
Name: cysteine-rich C-terminal 1
Synonyms: 2300002G24Rik, Nice-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74175
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: D130075K09Rik, 5430402I23Rik, LEC3, lectomedin 3, Lphn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319387
Homologene: 22878
Sema4b
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Synonyms: Semac, SemC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20352
Homologene: 8426
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, c-COT, Tpl-2, Cot/Tpl2, Tpl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, D630005A10Rik, A430040A19Rik, Bruce, A430032G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 12211
Homologene: 7248
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8l1, Sec8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20336
Homologene: 40654
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, jdf2, D7H15F37S1, rjs, D15F32S1h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Unk
Name: unkempt family zinc finger
Synonyms: B230379M23Rik, Zc3h5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217331
Homologene: 18194
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: Zfp291, D530014O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 244891
VEGA: 9
Homologene: 32488
Nav2
Name: neuron navigator 2
Synonyms: RAINB2, HELAD1, Unc53H2, 5330421F07Rik, POMFIL2, Rainb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 78286
Homologene: 52330
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, AnkG, Ankyrin-G, Ankyrin-3, 2900054D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103468
VEGA: 10
Homologene: 5555
Msr1
Name: macrophage scavenger receptor 1
Synonyms: MRS-A, SR-AII, SR-AI, MSR-A, Scara1, Scvr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 20288
HGNC: HGNC:7376
Homologene: 12822
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: DRO1, 2610001E17Rik, Ssg1, Urb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 67896
Homologene: 12206
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: 6530419G12Rik, MST027, A930009M04Rik, EFG2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 320806
Homologene: 6238
Rell1
Name: RELT-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100532
Homologene: 27084
Polr3c
Name: polymerase (RNA) III (DNA directed) polypeptide C
Synonyms: 4933407E01Rik, RPC3, RPC62
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74414
Homologene: 38185
Cntn2
Name: contactin 2
Synonyms: TAG1, axonin, Tax, D130012K04Rik, TAG-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21367
HGNC: HGNC:2172
Homologene: 3720
Galnt9
Name: polypeptide N-acetylgalactosaminyltransferase 9
Synonyms: GalNAc-T9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231605
HGNC: HGNC:4131
Homologene: 72793
Zdhhc6
Name: zinc finger, DHHC domain containing 6
Synonyms: 5930409M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 66980
VEGA: 19
Homologene: 41487
Cand1
Name: cullin associated and neddylation disassociated 1
Synonyms: 2310038O07Rik, D10Ertd516e, 6330512O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71902
Homologene: 10202
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Rpl10a
Name: ribosomal protein L10A
Synonyms: CsA-19, Nedd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 19896
Homologene: 68543
Helq
Name: helicase, POLQ-like
Synonyms: D430018E21Rik, Hel308
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 191578
Homologene: 14667
Dand5
Name: DAN domain family member 5, BMP antagonist
Synonyms: coco, Cerl2, GREM3, Cerl-2, Dte, Cerr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 23863
VEGA: 8
Homologene: 51883
Pcdh20
Name: protocadherin 20
Synonyms: C630015B17Rik, PCDH13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 219257
Homologene: 11277
4930522L14Rik
Name: RIKEN cDNA 4930522L14 gene
Synonyms: Gm42152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100041734
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: 4631426J05Rik, GalNAcS-6ST, MAd5, MAd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 77590
Homologene: 8908
Dpep2
Name: dipeptidase 2
Synonyms: F630103D06Rik, MBD-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 319446
Homologene: 49703
Dmkn
Name: dermokine
Synonyms: sk89, sk30, dermokine, cI-36, 1110014F24Rik, Dmkn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 73712
Homologene: 136295
Cnbp
Name: cellular nucleic acid binding protein
Synonyms: Znf9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12785
Homologene: 2567
Cdk12
Name: cyclin-dependent kinase 12
Synonyms: D11Ertd752e, 1810022J16Rik, Crk7, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69131
Homologene: 128632
Cars
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Kif24
Name: kinesin family member 24
Synonyms: 4933425J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 109242
Homologene: 52346
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225115
Homologene: 25090
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 104806
VEGA: 12
Homologene: 35378
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74144
Homologene: 10397
Tspan12
Name: tetraspanin 12
Synonyms: Tm4sf12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 269831
Homologene: 8212
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, tf, Itpr-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Kifc5b
Name: kinesin family member C5B
Synonyms: kinesin family c-terminal 5B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 16580
VEGA: 17
HGNC: HGNC:6389
Homologene: 83229
Tbccd1
Name: TBCC domain containing 1
Synonyms: 5730478M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 70573
VEGA: 16
Homologene: 32392
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270118
Homologene: 134147
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14972
HGNC: HGNC:4931
Homologene: 128352
Rpgrip1l
Name: Rpgrip1-like
Synonyms: fantom, Ftm, 1700047E16Rik, Nphp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244585
Homologene: 18296
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 213121
Homologene: 16977
Dusp8
Name: dual specificity phosphatase 8
Synonyms: Nttp1, 5530400B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18218
HGNC: HGNC:3074
Homologene: 31239
Fer1l6
Name: fer-1-like 6 (C. elegans)
Synonyms: EG631797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 631797
Homologene: 53396
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 22635
Homologene: 124417
Abcc9
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Synonyms: SUR2A, SUR2B, Sur2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227933
Homologene: 16353
Capn2
Name: calpain 2
Synonyms: m-calpain, Capa-2, Capa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12334
HGNC: HGNC:1479
Homologene: 1326
Glis3
Name: GLIS family zinc finger 3
Synonyms: 4833409N03Rik, E330013K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226075
Homologene: 34989
Rtraf-ps
Name: RNA transcription, translation and transport factor, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545536
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MYH-2B, Minmus, Minimsc, Myhsf, MM, MyHC-IIb, MHC2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Olfr975
Name: olfactory receptor 975
Synonyms: MOR224-2, GA_x6K02T2PVTD-33651220-33650288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258825
VEGA: 9
Homologene: 27275
Cdh24
Name: cadherin-like 24
Synonyms: cadherin 14-like, ENSMUSG00000022188, EY-cadherin, 1700040A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239096
VEGA: 14
Homologene: 56951
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 333315
Homologene: 35388
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239081
Homologene: 77905
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 72113
VEGA: 12
Homologene: 6493
Parp2
Name: poly (ADP-ribose) polymerase family, member 2
Synonyms: Aspartl2, Adprt2, C78626, PARP-2, Adprtl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 11546
VEGA: 14
HGNC: HGNC:272
Homologene: 4004
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68802
VEGA: 10
Homologene: 23778
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: Opo, ojoplano
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218165
VEGA: 13
Homologene: 125376
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 76645
Homologene: 124481
Acap1
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Synonyms: Centb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216859
Homologene: 22835
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 27411
VEGA: 18
Homologene: 5183
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, vascular endothelial growth factor receptor- 2, Flk-1, orv, Flk1, VEGFR-2, VEGFR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Bmp3
Name: bone morphogenetic protein 3
Synonyms: 9530029I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 110075
HGNC: HGNC:1070
Homologene: 927
Fbxo17
Name: F-box protein 17
Synonyms: FBXO26, Fbx17, Fbg4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 50760
Homologene: 17523
Alk
Name: anaplastic lymphoma kinase
Synonyms: CD246, Tcrz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Olfr1497
Name: olfactory receptor 1497
Synonyms: MOR212-1, GA_x6K02T2RE5P-4127765-4126821
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258736
Homologene: 17373
Unc5c
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 22253
Homologene: 2765
Slc26a11
Name: solute carrier family 26, member 11
Synonyms: F630021I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268512
Homologene: 13685
Slc6a21
Name: solute carrier family 6 member 21
Synonyms: 1700039E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 76713
Homologene: 66347
Dnase2b
Name: deoxyribonuclease II beta
Synonyms: Dlad, DnaseIIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56629
Homologene: 1052
Gm13078
Name: predicted gene 13078
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 277666
Homologene: 133722
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Myrf
Name: myelin regulatory factor
Synonyms: LOC386531, LOC225908, Gm98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Sgce
Name: sarcoglycan, epsilon
Synonyms: e-SG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20392
Homologene: 31205
Vnn3
Name: vanin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 26464
Homologene: 48295
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: VEGFR3, VEGFR-3, Flt-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Mical1
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms: Nical
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 171580
Homologene: 11246
Tigit
Name: T cell immunoreceptor with Ig and ITIM domains
Synonyms: Vstm3, ENSMUSG00000071552
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 100043314
VEGA: 16
Homologene: 18358
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: 21OH, 21-OH, Oh21-1, Cyp21, 21OHA, Oh21-1, 21-hydroxylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13079
Homologene: 68063
Cage1
Name: cancer antigen 1
Synonyms: 4933427I01Rik, Ctag3, CAGE1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 71213
Homologene: 18484
Adam3
Name: a disintegrin and metallopeptidase domain 3 (cyritestin)
Synonyms: Cyrn1, tMDC, Taz83, ADAM3, Taz83
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Slc17a9
Name: solute carrier family 17, member 9
Synonyms: 1700019H03Rik, Vnut
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228993
Homologene: 76562
Krt39
Name: keratin 39
Synonyms: 4732494G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237934
Homologene: 19078
Ccl25
Name: chemokine (C-C motif) ligand 25
Synonyms: CKb15, TECK, Scya25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 20300
Homologene: 4109
Egfl7
Name: EGF-like domain 7
Synonyms: Zneu1, VE-statin, vascular endothelial-statin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 353156
Homologene: 9427
Fpr-rs7
Name: formyl peptide receptor, related sequence 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 321021
Slc22a7
Name: solute carrier family 22 (organic anion transporter), member 7
Synonyms: OAT2, NLT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 108114
VEGA: 17
Homologene: 21328
Slc35f1
Name: solute carrier family 35, member F1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215085
Homologene: 33552
Kank3
Name: KN motif and ankyrin repeat domains 3
Synonyms: D17Ertd288e, 0610013D04Rik, Ankrd47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 80880
Homologene: 12749
Vmn1r192
Name: vomeronasal 1 receptor 192
Synonyms: V1ri1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 252907
Homologene: 110880
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 50524
Homologene: 9269
Eef1akmt1
Name: EEF1A alpha lysine methyltransferase 1
Synonyms: Ayu21-96, Gt(Ayu21)96Imeg, 2510005D08Rik, N6amt2, GtAyu21-96
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 68043
VEGA: 14
Homologene: 5952
Mbd3
Name: methyl-CpG binding domain protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17192
HGNC: HGNC:6918
Homologene: 2917
Selp
Name: selectin, platelet
Synonyms: P-selectin, CD62P, Grmp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20344
Homologene: 2260
Sars2
Name: seryl-aminoacyl-tRNA synthetase 2
Synonyms: D7Ertd353e, 2410015F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71984
Homologene: 6073
Nat8b-ps
Name: N-acetyltransferase 8B, pseudogene
Synonyms: Nat8b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 434057
Spata21
Name: spermatogenesis associated 21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 329972
Homologene: 18639
Olfr597
Name: olfactory receptor 597
Synonyms: MOR23-2, GA_x6K02T2PBJ9-6029614-6030561
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258135
Homologene: 132401
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Hbb-bs
Name: hemoglobin, beta adult s chain
Synonyms: beta s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100503605
HGNC: HGNC:4827
Homologene: 68066
Kat2b-ps
Name: K(lysine) acetyltransferase 2B, pseudogene
Synonyms: P/CAF pseudogene, Pcaf-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100504388
Rps18-ps3
Name: ribosomal protein S18, pseudogene 3
Synonyms: Gm10027
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 100042791
E030037K01Rik
Name: RIKEN cDNA E030037K01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
8430432A02Rik
Name: RIKEN cDNA 8430432A02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108167597
Gm15354
Name: predicted gene 15354
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
Ighv5-9-1
Name: immunoglobulin heavy variable 5-9-1
Synonyms: Gm16886
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 641178
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,092,727 bp
  • A to T, chromosome 1 at 132,516,032 bp
  • A to G, chromosome 1 at 164,141,397 bp
  • G to A, chromosome 1 at 182,492,037 bp
  • G to T, chromosome 2 at 26,590,980 bp
  • T to C, chromosome 2 at 48,893,541 bp
  • T to C, chromosome 2 at 58,829,802 bp
  • T to A, chromosome 2 at 71,282,635 bp
  • T to C, chromosome 2 at 180,735,949 bp
  • A to G, chromosome 3 at 88,576,980 bp
  • A to G, chromosome 3 at 93,014,825 bp
  • C to A, chromosome 3 at 96,684,824 bp
  • T to C, chromosome 3 at 96,723,773 bp
  • T to A, chromosome 3 at 141,788,966 bp
  • T to A, chromosome 3 at 146,593,441 bp
  • G to T, chromosome 4 at 41,394,329 bp
  • A to T, chromosome 4 at 141,112,091 bp
  • A to T, chromosome 4 at 143,728,326 bp
  • A to T, chromosome 5 at 24,701,469 bp
  • C to A, chromosome 5 at 63,936,033 bp
  • G to A, chromosome 5 at 75,961,848 bp
  • G to T, chromosome 5 at 81,512,110 bp
  • A to G, chromosome 5 at 93,391,524 bp
  • C to A, chromosome 5 at 98,872,061 bp
  • A to T, chromosome 5 at 100,791,942 bp
  • A to T, chromosome 5 at 109,737,796 bp
  • A to G, chromosome 5 at 110,577,449 bp
  • A to G, chromosome 5 at 110,665,810 bp
  • T to C, chromosome 5 at 137,408,370 bp
  • A to T, chromosome 6 at 4,694,153 bp
  • A to C, chromosome 6 at 21,835,449 bp
  • A to G, chromosome 6 at 33,910,517 bp
  • A to G, chromosome 6 at 85,628,546 bp
  • T to C, chromosome 6 at 85,932,754 bp
  • T to C, chromosome 6 at 87,845,146 bp
  • T to C, chromosome 6 at 142,590,436 bp
  • A to G, chromosome 7 at 28,732,789 bp
  • T to C, chromosome 7 at 28,752,438 bp
  • A to T, chromosome 7 at 30,771,233 bp
  • A to G, chromosome 7 at 45,288,310 bp
  • A to G, chromosome 7 at 49,409,001 bp
  • T to A, chromosome 7 at 56,229,690 bp
  • T to A, chromosome 7 at 80,198,756 bp
  • A to T, chromosome 7 at 103,320,543 bp
  • G to A, chromosome 7 at 103,826,720 bp
  • T to A, chromosome 7 at 132,247,884 bp
  • GCCACCACCACCACCACCACCACC to GCCACCACCACCACCACCACC, chromosome 7 at 142,082,154 bp
  • T to C, chromosome 7 at 143,569,475 bp
  • A to G, chromosome 8 at 4,353,913 bp
  • T to C, chromosome 8 at 24,684,614 bp
  • T to C, chromosome 8 at 39,624,251 bp
  • A to T, chromosome 8 at 47,713,302 bp
  • C to T, chromosome 8 at 66,387,406 bp
  • A to T, chromosome 8 at 75,096,004 bp
  • T to A, chromosome 8 at 80,613,136 bp
  • C to T, chromosome 8 at 84,816,484 bp
  • T to C, chromosome 8 at 91,261,009 bp
  • G to A, chromosome 8 at 105,942,442 bp
  • T to G, chromosome 8 at 105,989,408 bp
  • T to C, chromosome 8 at 107,262,920 bp
  • T to C, chromosome 8 at 117,054,885 bp
  • A to T, chromosome 8 at 117,072,549 bp
  • T to C, chromosome 9 at 13,621,175 bp
  • G to A, chromosome 9 at 37,402,560 bp
  • A to C, chromosome 9 at 39,950,225 bp
  • A to G, chromosome 9 at 55,892,235 bp
  • G to A, chromosome 9 at 101,153,854 bp
  • A to T, chromosome 10 at 23,864,575 bp
  • A to G, chromosome 10 at 41,478,457 bp
  • A to G, chromosome 10 at 53,062,602 bp
  • G to A, chromosome 10 at 63,147,936 bp
  • C to T, chromosome 10 at 70,002,109 bp
  • G to T, chromosome 10 at 80,395,576 bp
  • A to G, chromosome 10 at 117,770,511 bp
  • A to G, chromosome 10 at 119,212,018 bp
  • T to C, chromosome 11 at 49,627,143 bp
  • T to A, chromosome 11 at 67,254,028 bp
  • A to G, chromosome 11 at 69,887,193 bp
  • A to T, chromosome 11 at 98,222,687 bp
  • A to G, chromosome 11 at 99,514,749 bp
  • A to G, chromosome 11 at 116,006,605 bp
  • A to G, chromosome 11 at 116,054,945 bp
  • A to G, chromosome 11 at 119,370,832 bp
  • T to C, chromosome 12 at 65,077,141 bp
  • T to C, chromosome 12 at 88,441,138 bp
  • C to T, chromosome 12 at 113,736,294 bp
  • A to C, chromosome 13 at 22,187,480 bp
  • G to A, chromosome 13 at 38,019,208 bp
  • A to G, chromosome 13 at 40,214,517 bp
  • T to A, chromosome 13 at 97,175,676 bp
  • A to T, chromosome 14 at 50,362,885 bp
  • C to A, chromosome 14 at 50,819,268 bp
  • T to C, chromosome 14 at 52,315,393 bp
  • C to T, chromosome 14 at 54,633,215 bp
  • C to T, chromosome 14 at 57,550,632 bp
  • A to G, chromosome 14 at 88,469,726 bp
  • G to T, chromosome 15 at 58,600,311 bp
  • A to G, chromosome 15 at 102,315,241 bp
  • T to C, chromosome 16 at 22,841,899 bp
  • C to T, chromosome 16 at 32,847,294 bp
  • A to T, chromosome 16 at 43,662,017 bp
  • A to T, chromosome 16 at 45,118,167 bp
  • T to C, chromosome 17 at 20,113,820 bp
  • C to T, chromosome 17 at 26,921,023 bp
  • T to C, chromosome 17 at 27,098,005 bp
  • T to C, chromosome 17 at 28,330,852 bp
  • G to T, chromosome 17 at 33,817,200 bp
  • A to G, chromosome 17 at 33,997,076 bp
  • G to A, chromosome 17 at 34,803,393 bp
  • T to G, chromosome 17 at 46,436,933 bp
  • T to C, chromosome 17 at 71,904,315 bp
  • T to A, chromosome 17 at 74,650,099 bp
  • G to A, chromosome 18 at 4,349,124 bp
  • A to G, chromosome 18 at 5,108,631 bp
  • A to G, chromosome 18 at 37,743,472 bp
  • G to T, chromosome 18 at 78,192,188 bp
  • A to T, chromosome 19 at 10,210,632 bp
  • T to C, chromosome 19 at 13,795,465 bp
  • T to C, chromosome 19 at 28,666,104 bp
  • T to C, chromosome 19 at 55,313,210 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4921 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042523-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.