Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4921Btlr/Mmmh
Stock Number:
042523-MU
Citation ID:
RRID:MMRRC_042523-MU
Other Names:
R4921 (G1), C57BL/6J-MtgxR4921Btlr
Major Collection:

Strain Information

Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100502698
Homologene: 15687
Lcat
Name: lecithin cholesterol acyltransferase
Synonyms: D8Wsu61e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16816
HGNC: HGNC:6522
Homologene: 68042
Acvr2a
Name: activin receptor IIA
Synonyms: ActRIIa, tActRII, Acvr2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11480
HGNC: HGNC:173
Homologene: 20391
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53312
Homologene: 41108
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,092,727 bp
  • A to T, chromosome 1 at 132,516,032 bp
  • A to G, chromosome 1 at 164,141,397 bp
  • G to A, chromosome 1 at 182,492,037 bp
  • G to T, chromosome 2 at 26,590,980 bp
  • T to C, chromosome 2 at 48,893,541 bp
  • T to C, chromosome 2 at 58,829,802 bp
  • T to A, chromosome 2 at 71,282,635 bp
  • T to C, chromosome 2 at 180,735,949 bp
  • A to G, chromosome 3 at 88,576,980 bp
  • A to G, chromosome 3 at 93,014,825 bp
  • C to A, chromosome 3 at 96,684,824 bp
  • T to C, chromosome 3 at 96,723,773 bp
  • T to A, chromosome 3 at 141,788,966 bp
  • T to A, chromosome 3 at 146,593,441 bp
  • G to T, chromosome 4 at 41,394,329 bp
  • A to T, chromosome 4 at 141,112,091 bp
  • A to T, chromosome 4 at 143,728,326 bp
  • A to T, chromosome 5 at 24,701,469 bp
  • C to A, chromosome 5 at 63,936,033 bp
  • G to A, chromosome 5 at 75,961,848 bp
  • G to T, chromosome 5 at 81,512,110 bp
  • A to G, chromosome 5 at 93,391,524 bp
  • C to A, chromosome 5 at 98,872,061 bp
  • A to T, chromosome 5 at 100,791,942 bp
  • A to T, chromosome 5 at 109,737,796 bp
  • A to G, chromosome 5 at 110,577,449 bp
  • A to G, chromosome 5 at 110,665,810 bp
  • T to C, chromosome 5 at 137,408,370 bp
  • A to T, chromosome 6 at 4,694,153 bp
  • A to C, chromosome 6 at 21,835,449 bp
  • A to G, chromosome 6 at 33,910,517 bp
  • A to G, chromosome 6 at 85,628,546 bp
  • T to C, chromosome 6 at 85,932,754 bp
  • T to C, chromosome 6 at 87,845,146 bp
  • T to C, chromosome 6 at 142,590,436 bp
  • A to G, chromosome 7 at 28,732,789 bp
  • T to C, chromosome 7 at 28,752,438 bp
  • A to T, chromosome 7 at 30,771,233 bp
  • A to G, chromosome 7 at 45,288,310 bp
  • A to G, chromosome 7 at 49,409,001 bp
  • T to A, chromosome 7 at 56,229,690 bp
  • T to A, chromosome 7 at 80,198,756 bp
  • A to T, chromosome 7 at 103,320,543 bp
  • G to A, chromosome 7 at 103,826,720 bp
  • T to A, chromosome 7 at 132,247,884 bp
  • GCCACCACCACCACCACCACCACC to GCCACCACCACCACCACCACC, chromosome 7 at 142,082,154 bp
  • T to C, chromosome 7 at 143,569,475 bp
  • A to G, chromosome 8 at 4,353,913 bp
  • T to C, chromosome 8 at 24,684,614 bp
  • T to C, chromosome 8 at 39,624,251 bp
  • A to T, chromosome 8 at 47,713,302 bp
  • C to T, chromosome 8 at 66,387,406 bp
  • A to T, chromosome 8 at 75,096,004 bp
  • T to A, chromosome 8 at 80,613,136 bp
  • C to T, chromosome 8 at 84,816,484 bp
  • T to C, chromosome 8 at 91,261,009 bp
  • G to A, chromosome 8 at 105,942,442 bp
  • T to G, chromosome 8 at 105,989,408 bp
  • T to C, chromosome 8 at 107,262,920 bp
  • T to C, chromosome 8 at 117,054,885 bp
  • A to T, chromosome 8 at 117,072,549 bp
  • T to C, chromosome 9 at 13,621,175 bp
  • G to A, chromosome 9 at 37,402,560 bp
  • A to C, chromosome 9 at 39,950,225 bp
  • A to G, chromosome 9 at 55,892,235 bp
  • G to A, chromosome 9 at 101,153,854 bp
  • A to T, chromosome 10 at 23,864,575 bp
  • A to G, chromosome 10 at 41,478,457 bp
  • A to G, chromosome 10 at 53,062,602 bp
  • G to A, chromosome 10 at 63,147,936 bp
  • C to T, chromosome 10 at 70,002,109 bp
  • G to T, chromosome 10 at 80,395,576 bp
  • A to G, chromosome 10 at 117,770,511 bp
  • A to G, chromosome 10 at 119,212,018 bp
  • T to C, chromosome 11 at 49,627,143 bp
  • T to A, chromosome 11 at 67,254,028 bp
  • A to G, chromosome 11 at 69,887,193 bp
  • A to T, chromosome 11 at 98,222,687 bp
  • A to G, chromosome 11 at 99,514,749 bp
  • A to G, chromosome 11 at 116,006,605 bp
  • A to G, chromosome 11 at 116,054,945 bp
  • A to G, chromosome 11 at 119,370,832 bp
  • T to C, chromosome 12 at 65,077,141 bp
  • T to C, chromosome 12 at 88,441,138 bp
  • C to T, chromosome 12 at 113,736,294 bp
  • A to C, chromosome 13 at 22,187,480 bp
  • G to A, chromosome 13 at 38,019,208 bp
  • A to G, chromosome 13 at 40,214,517 bp
  • T to A, chromosome 13 at 97,175,676 bp
  • A to T, chromosome 14 at 50,362,885 bp
  • C to A, chromosome 14 at 50,819,268 bp
  • T to C, chromosome 14 at 52,315,393 bp
  • C to T, chromosome 14 at 54,633,215 bp
  • C to T, chromosome 14 at 57,550,632 bp
  • A to G, chromosome 14 at 88,469,726 bp
  • G to T, chromosome 15 at 58,600,311 bp
  • A to G, chromosome 15 at 102,315,241 bp
  • T to C, chromosome 16 at 22,841,899 bp
  • C to T, chromosome 16 at 32,847,294 bp
  • A to T, chromosome 16 at 43,662,017 bp
  • A to T, chromosome 16 at 45,118,167 bp
  • T to C, chromosome 17 at 20,113,820 bp
  • C to T, chromosome 17 at 26,921,023 bp
  • T to C, chromosome 17 at 27,098,005 bp
  • T to C, chromosome 17 at 28,330,852 bp
  • G to T, chromosome 17 at 33,817,200 bp
  • A to G, chromosome 17 at 33,997,076 bp
  • G to A, chromosome 17 at 34,803,393 bp
  • T to G, chromosome 17 at 46,436,933 bp
  • T to C, chromosome 17 at 71,904,315 bp
  • T to A, chromosome 17 at 74,650,099 bp
  • G to A, chromosome 18 at 4,349,124 bp
  • A to G, chromosome 18 at 5,108,631 bp
  • A to G, chromosome 18 at 37,743,472 bp
  • G to T, chromosome 18 at 78,192,188 bp
  • A to T, chromosome 19 at 10,210,632 bp
  • T to C, chromosome 19 at 13,795,465 bp
  • T to C, chromosome 19 at 28,666,104 bp
  • T to C, chromosome 19 at 55,313,210 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4921 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042523-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.