Strain Name:
C57BL/6J-MtgxR4931Btlr/Mmmh
Stock Number:
042532-MU
Citation ID:
RRID:MMRRC_042532-MU
Other Names:
R4931 (G1), C57BL/6J-MtgxR4931Btlr
Major Collection:

Gene Information

Prkacb
Name: protein kinase, cAMP dependent, catalytic, beta
Synonyms: cAMP-dependent protein kinase C beta, Pkacb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18749
HGNC: HGNC:9381
Homologene: 121718
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: Cerp, PRCE, ESP1, separase, PRCE, SSE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105988
VEGA: 15
Homologene: 32151
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: Acra-4, Acra4, a4 nicotinic receptor, alpha4 nAChR, alpha4-nAChR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Egf
Name: epidermal growth factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 13645
HGNC: HGNC:3229
Homologene: 1483
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Mindy3
Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, Fam188a, 5830410F13Rik, 2310047O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66960
Homologene: 11478
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 1810061H24Rik, SAP130, RSE1, D8Ertd633e, 5730409A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 101943
Homologene: 6579
Fbrsl1
Name: fibrosin-like 1
Synonyms: LOC381668, Gm29766, 2410025L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381668
Homologene: 45966
Mtdh
Name: metadherin
Synonyms: D8Bwg1112e, Lyric, 3D3/Lyric, AEG-1, 2610103J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 67154
Homologene: 12089
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, sy-ns, Nkcc1, mBSC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 20496
VEGA: 18
Homologene: 20283
Ndufa9
Name: NADH:ubiquinone oxidoreductase subunit A9
Synonyms: 1010001N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 66108
HGNC: HGNC:7693
Homologene: 3666
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239250
VEGA: 14
Homologene: 12986
Eif2d
Name: eukaryotic translation initiation factor 2D
Synonyms: Lgtn, D1Ertd5e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16865
HGNC: HGNC:6583
Homologene: 38244
Acy1
Name: aminoacylase 1
Synonyms: 1110014J22Rik, Acy-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 109652
HGNC: HGNC:177
Homologene: 110440
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 22041
Homologene: 68153
Rnd2
Name: Rho family GTPase 2
Synonyms: Rohn, Arhn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11858
Homologene: 21123
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: AF529169, DD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 209743
Homologene: 17782
Sppl3
Name: signal peptide peptidase 3
Synonyms: Usmg3, 4833416I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 74585
Homologene: 15563
Rad1
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 19355
HGNC: HGNC:9806
Homologene: 37695
Magel2
Name: melanoma antigen, family L, 2
Synonyms: Mage-l2, NDNL1, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
E130114P18Rik
Name: RIKEN cDNA E130114P18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 319865
HGNC: null
Homologene: null
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Kif13a
Name: kinesin family member 13A
Synonyms: 4930505I07Rik, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16553
VEGA: 13
Homologene: 22589
Dapk1
Name: death associated protein kinase 1
Synonyms: 2810425C21Rik, 2310039H24Rik, DAP-Kinase, D13Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Zfp296
Name: zinc finger protein 296
Synonyms: 2210018A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 63872
Homologene: 11185
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226169
Homologene: 9006
Tpcn2
Name: two pore segment channel 2
Synonyms: D830047E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233979
Homologene: 16375
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235048
HGNC: null
Homologene: 138456
Ttyh1
Name: tweety family member 1
Synonyms: 6330408P11Rik, 4930459B04Rik, tty
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57776
Homologene: 10779
Mir719
Name: microRNA 719
Synonyms: mir 719, Mirn719, mmu-mir-719
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 751526
VEGA: 14
HGNC: null
Homologene: null
Gpatch8
Name: G patch domain containing 8
Synonyms: 5430405G24Rik, Gpatc8, ENSMUSG00000075516, Fbm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237943
Homologene: 46117
Ltbr
Name: lymphotoxin B receptor
Synonyms: Ltar, LT beta-R, TNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, Tnfbr, Tnfrsf3, LT-beta receptor, TNF receptor-related protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627636
HGNC: null
Homologene: 115024
Itgb2l
Name: integrin beta 2-like
Synonyms: 5033406G21Rik, pactolus
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 16415
HGNC: null
Homologene: null
Eps8l1
Name: EPS8-like 1
Synonyms: 4632407K17Rik, EPS8R1, 2310051G19Rik, DRC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67425
Homologene: 15767
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1alpha, RIM1, C030033M19Rik, RIM1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116837
Homologene: 128399
4930402H24Rik
Name: RIKEN cDNA 4930402H24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228602
Homologene: 12623
Olfr869
Name: olfactory receptor 869
Synonyms: MOR145-6, GA_x6K02T2PVTD-13878275-13879204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258550
HGNC: null
Homologene: 138312
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 214593
Homologene: 9689
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231470
Homologene: 23516
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 236537
HGNC: null
Homologene: 45160
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 78809
Homologene: 53527
Ush1c
Name: USH1 protein network component harmonin
Synonyms: harmonin, 2010016F01Rik, Usher syndrome 1C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 72088
Homologene: 77476
Gucy1a2
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: A230060L24Rik, 6330407I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 234889
HGNC: HGNC:4684
Homologene: 47953
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: A730013O20Rik, 5730592G18Rik, C130038G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 77521
Homologene: 78141
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 234857
Homologene: 72212
2410004B18Rik
Name: RIKEN cDNA 2410004B18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 66421
Homologene: 11968
Ccdc33
Name: coiled-coil domain containing 33
Synonyms: LOC382077, 4930535E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 382077
Homologene: 19641
Nanog
Name: Nanog homeobox
Synonyms: ecat4, 2410002E02Rik, ENK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 71950
Homologene: 78027
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241073
Homologene: 104042
Krt31
Name: keratin 31
Synonyms: MKHA-1, Krt1-1, Kha1, Ha1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16660
HGNC: HGNC:6448
Homologene: 74433
Cd209f
Name: CD209f antigen
Synonyms: 1810029C22Rik, SIGNR8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 69142
HGNC: null
Homologene: 114519
Cers6
Name: ceramide synthase 6
Synonyms: similar to TRH1, CerS6, Lass6, T1L, 4732462C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241447
Homologene: 72228
Tnfrsf13b
Name: tumor necrosis factor receptor superfamily, member 13b
Synonyms: 1200009E08Rik, Taci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 57916
Homologene: 49320
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: Nope, WI-16786, WI-18508, 9330155G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 56741
VEGA: 9
Homologene: 10570
Ankrd40
Name: ankyrin repeat domain 40
Synonyms: 5530600A18Rik, Gcap15, 1110011C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71452
Homologene: 12393
B3gnt9
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms: B3gnt9-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 97440
Homologene: 13250
Tcl1
Name: T cell lymphoma breakpoint 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 21432
Homologene: 7565
Gm12800
Name: predicted gene 12800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381535
HGNC: null
Homologene: null
Olfr619
Name: olfactory receptor 619
Synonyms: GA_x6K02T2PBJ9-6326488-6327450, MOR31-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259080
HGNC: null
Homologene: 45095
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68047
Homologene: 12231
Ten1
Name: TEN1 telomerase capping complex subunit
Synonyms: 2310004N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69535
Homologene: 28494
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,533,947 bp
  • T to G, chromosome 1 at 63,633,678 bp
  • T to A, chromosome 1 at 131,154,391 bp
  • C to G, chromosome 1 at 189,851,277 bp
  • A to T, chromosome 2 at 12,396,213 bp
  • T to G, chromosome 2 at 69,105,112 bp
  • T to C, chromosome 2 at 122,296,755 bp
  • A to G, chromosome 2 at 130,741,873 bp
  • A to G, chromosome 2 at 181,028,872 bp
  • A to G, chromosome 3 at 129,711,468 bp
  • A to G, chromosome 3 at 145,938,120 bp
  • T to C, chromosome 3 at 146,747,977 bp
  • A to C, chromosome 4 at 45,803,661 bp
  • A to G, chromosome 4 at 90,224,304 bp
  • T to C, chromosome 4 at 97,720,287 bp
  • T to C, chromosome 4 at 101,909,170 bp
  • T to A, chromosome 5 at 96,636,840 bp
  • A to T, chromosome 5 at 110,379,029 bp
  • A to T, chromosome 5 at 115,082,314 bp
  • A to G, chromosome 5 at 137,291,914 bp
  • C to T, chromosome 5 at 148,077,416 bp
  • G to A, chromosome 6 at 122,707,906 bp
  • G to T, chromosome 6 at 125,307,474 bp
  • G to T, chromosome 6 at 126,836,320 bp
  • A to G, chromosome 7 at 4,133,944 bp
  • A to G, chromosome 7 at 4,471,241 bp
  • G to T, chromosome 7 at 19,579,712 bp
  • A to T, chromosome 7 at 46,197,231 bp
  • A to G, chromosome 7 at 62,380,624 bp
  • T to G, chromosome 7 at 103,604,374 bp
  • A to T, chromosome 7 at 128,204,625 bp
  • G to A, chromosome 7 at 145,267,309 bp
  • A to T, chromosome 8 at 4,103,688 bp
  • T to C, chromosome 8 at 27,394,230 bp
  • T to C, chromosome 8 at 105,254,244 bp
  • C to T, chromosome 8 at 110,816,329 bp
  • A to G, chromosome 8 at 123,368,784 bp
  • A to G, chromosome 9 at 3,759,588 bp
  • A to T, chromosome 9 at 20,137,562 bp
  • A to T, chromosome 9 at 22,258,123 bp
  • T to C, chromosome 9 at 58,069,851 bp
  • A to G, chromosome 9 at 65,124,015 bp
  • T to C, chromosome 9 at 89,601,652 bp
  • C to A, chromosome 9 at 103,228,048 bp
  • G to A, chromosome 9 at 106,433,191 bp
  • A to T, chromosome 11 at 61,140,937 bp
  • T to A, chromosome 11 at 94,334,821 bp
  • G to A, chromosome 11 at 100,050,157 bp
  • C to T, chromosome 11 at 101,468,999 bp
  • T to C, chromosome 11 at 102,481,224 bp
  • T to C, chromosome 11 at 116,205,729 bp
  • G to T, chromosome 12 at 105,222,613 bp
  • A to G, chromosome 13 at 46,809,055 bp
  • T to C, chromosome 13 at 60,760,960 bp
  • G to T, chromosome 14 at 60,228,842 bp
  • A to G, chromosome 14 at 110,750,379 bp
  • T to C, chromosome 15 at 10,492,762 bp
  • T to C, chromosome 15 at 34,083,239 bp
  • A to G, chromosome 15 at 102,305,730 bp
  • T to C, chromosome 16 at 4,861,046 bp
  • T to A, chromosome 16 at 96,437,449 bp
  • A to T, chromosome 17 at 19,811,769 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • T to G, chromosome 17 at 56,012,362 bp
  • A to G, chromosome 18 at 57,934,963 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 19 at 46,071,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4931 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042532-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.