Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4931Btlr/Mmmh
Stock Number:
042532-MU
Citation ID:
RRID:MMRRC_042532-MU
Other Names:
R4931 (G1), C57BL/6J-MtgxR4931Btlr
Major Collection:

Strain Information

Prkacb
Name: protein kinase, cAMP dependent, catalytic, beta
Synonyms: cAMP-dependent protein kinase C beta, Pkacb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18749
HGNC: HGNC:9381
Homologene: 121718
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: alpha4 nAChR, Acra-4, Acra4, a4 nicotinic receptor, alpha4-nAChR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Mindy3
Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, 5830410F13Rik, 2310047O13Rik, Fam188a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66960
Homologene: 11478
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,533,947 bp
  • T to G, chromosome 1 at 63,633,678 bp
  • T to A, chromosome 1 at 131,154,391 bp
  • C to G, chromosome 1 at 189,851,277 bp
  • A to T, chromosome 2 at 12,396,213 bp
  • T to G, chromosome 2 at 69,105,112 bp
  • T to C, chromosome 2 at 122,296,755 bp
  • A to G, chromosome 2 at 130,741,873 bp
  • A to G, chromosome 2 at 181,028,872 bp
  • A to G, chromosome 3 at 129,711,468 bp
  • A to G, chromosome 3 at 145,938,120 bp
  • T to C, chromosome 3 at 146,747,977 bp
  • A to C, chromosome 4 at 45,803,661 bp
  • A to G, chromosome 4 at 90,224,304 bp
  • T to C, chromosome 4 at 97,720,287 bp
  • T to C, chromosome 4 at 101,909,170 bp
  • T to A, chromosome 5 at 96,636,840 bp
  • A to T, chromosome 5 at 110,379,029 bp
  • A to T, chromosome 5 at 115,082,314 bp
  • A to G, chromosome 5 at 137,291,914 bp
  • C to T, chromosome 5 at 148,077,416 bp
  • G to A, chromosome 6 at 122,707,906 bp
  • G to T, chromosome 6 at 125,307,474 bp
  • G to T, chromosome 6 at 126,836,320 bp
  • A to G, chromosome 7 at 4,133,944 bp
  • A to G, chromosome 7 at 4,471,241 bp
  • G to T, chromosome 7 at 19,579,712 bp
  • A to T, chromosome 7 at 46,197,231 bp
  • A to G, chromosome 7 at 62,380,624 bp
  • T to G, chromosome 7 at 103,604,374 bp
  • A to T, chromosome 7 at 128,204,625 bp
  • G to A, chromosome 7 at 145,267,309 bp
  • A to T, chromosome 8 at 4,103,688 bp
  • T to C, chromosome 8 at 27,394,230 bp
  • T to C, chromosome 8 at 105,254,244 bp
  • C to T, chromosome 8 at 110,816,329 bp
  • A to G, chromosome 8 at 123,368,784 bp
  • A to G, chromosome 9 at 3,759,588 bp
  • A to T, chromosome 9 at 20,137,562 bp
  • A to T, chromosome 9 at 22,258,123 bp
  • T to C, chromosome 9 at 58,069,851 bp
  • A to G, chromosome 9 at 65,124,015 bp
  • T to C, chromosome 9 at 89,601,652 bp
  • C to A, chromosome 9 at 103,228,048 bp
  • G to A, chromosome 9 at 106,433,191 bp
  • A to T, chromosome 11 at 61,140,937 bp
  • T to A, chromosome 11 at 94,334,821 bp
  • G to A, chromosome 11 at 100,050,157 bp
  • C to T, chromosome 11 at 101,468,999 bp
  • T to C, chromosome 11 at 102,481,224 bp
  • T to C, chromosome 11 at 116,205,729 bp
  • G to T, chromosome 12 at 105,222,613 bp
  • A to G, chromosome 13 at 46,809,055 bp
  • T to C, chromosome 13 at 60,760,960 bp
  • G to T, chromosome 14 at 60,228,842 bp
  • A to G, chromosome 14 at 110,750,379 bp
  • T to C, chromosome 15 at 10,492,762 bp
  • T to C, chromosome 15 at 34,083,239 bp
  • A to G, chromosome 15 at 102,305,730 bp
  • T to C, chromosome 16 at 4,861,046 bp
  • T to A, chromosome 16 at 96,437,449 bp
  • A to T, chromosome 17 at 19,811,769 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • T to G, chromosome 17 at 56,012,362 bp
  • A to G, chromosome 18 at 57,934,963 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 19 at 46,071,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4931 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042532-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.