Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4931Btlr/Mmmh
Stock Number:
042532-MU
Citation ID:
RRID:MMRRC_042532-MU
Other Names:
R4931 (G1), C57BL/6J-MtgxR4931Btlr
Major Collection:

Strain Information

Prkacb
Name: protein kinase, cAMP dependent, catalytic, beta
Synonyms: cAMP-dependent protein kinase C beta, Pkacb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18749
HGNC: HGNC:9381
Homologene: 121718
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: alpha4 nAChR, Acra-4, Acra4, a4 nicotinic receptor, alpha4-nAChR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Mindy3
Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, 5830410F13Rik, 2310047O13Rik, Fam188a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66960
Homologene: 11478
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Fbrsl1
Name: fibrosin-like 1
Synonyms: LOC381668, 2410025L10Rik, Gm29766
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381668
Homologene: 45966
Mtdh
Name: metadherin
Synonyms: D8Bwg1112e, 3D3/Lyric, Lyric, 2610103J23Rik, AEG-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67154
Homologene: 12089
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, mBSC2, Nkcc1, sy-ns
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Ndufa9
Name: NADH:ubiquinone oxidoreductase subunit A9
Synonyms: 1010001N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66108
HGNC: HGNC:7693
Homologene: 3666
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239250
VEGA: 14
Homologene: 12986
Eif2d
Name: eukaryotic translation initiation factor 2D
Synonyms: D1Ertd5e, Lgtn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16865
HGNC: HGNC:6583
Homologene: 38244
Acy1
Name: aminoacylase 1
Synonyms: Acy-1, 1110014J22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109652
HGNC: HGNC:177
Homologene: 110440
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Rnd2
Name: Rho family GTPase 2
Synonyms: Arhn, Rohn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11858
Homologene: 21123
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209743
Homologene: 17782
Sppl3
Name: signal peptide peptidase 3
Synonyms: 4833416I09Rik, Usmg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74585
Homologene: 15563
Rad1
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19355
HGNC: HGNC:9806
Homologene: 37695
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
E130114P18Rik
Name: RIKEN cDNA E130114P18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 319865
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, D13Ucla1, 2810425C21Rik, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Zfp296
Name: zinc finger protein 296
Synonyms: 2210018A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 63872
Homologene: 11185
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Tpcn2
Name: two pore segment channel 2
Synonyms: D830047E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233979
Homologene: 16375
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Mir719
Name: microRNA 719
Synonyms: mir 719, mmu-mir-719, Mirn719
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 751526
VEGA: 14
Gpatch8
Name: G patch domain containing 8
Synonyms: 5430405G24Rik, Gpatc8, ENSMUSG00000075516, Fbm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Ltbr
Name: lymphotoxin B receptor
Synonyms: TNFRrp, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Ltar, TNF-R-III, TNFCR, TNFR2-RP, LTbetaR, Tnfrsf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627636
Homologene: 115024
Itgb2l
Name: integrin beta 2-like
Synonyms: pactolus, 5033406G21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16415
HGNC: HGNC:6155
Eps8l1
Name: EPS8-like 1
Synonyms: 4632407K17Rik, EPS8R1, DRC3, 2310051G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67425
Homologene: 15767
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Or7e175
Name: olfactory receptor family 7 subfamily E member 175
Synonyms: GA_x6K02T2PVTD-13878275-13879204, MOR145-6, Olfr869
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258550
HGNC: HGNC:8396
Homologene: 138312
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
Ush1c
Name: USH1 protein network component harmonin
Synonyms: 2010016F01Rik, harmonin, Usher syndrome 1C
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72088
Homologene: 77476
Gucy1a2
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: 6330407I18Rik, A230060L24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234889
HGNC: HGNC:4684
Homologene: 47953
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: 5730592G18Rik, A730013O20Rik, C130038G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
2410004B18Rik
Name: RIKEN cDNA 2410004B18 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66421
Homologene: 11968
Ccdc33
Name: coiled-coil domain containing 33
Synonyms: LOC382077, 4930535E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382077
Homologene: 19641
Nanog
Name: Nanog homeobox
Synonyms: 2410002E02Rik, ENK, ecat4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71950
Homologene: 78027
Dytn
Name: dystrotelin
Synonyms: LOC241073
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241073
Homologene: 104042
Krt31
Name: keratin 31
Synonyms: Ha1, Kha1, MKHA-1, Krt1-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16660
HGNC: HGNC:6448
Homologene: 74433
Cd209f
Name: CD209f antigen
Synonyms: SIGNR8, 1810029C22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69142
Homologene: 114519
Cers6
Name: ceramide synthase 6
Synonyms: T1L, similar to TRH1, 4732462C07Rik, CerS6, Lass6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241447
Homologene: 72228
Tnfrsf13b
Name: tumor necrosis factor receptor superfamily, member 13b
Synonyms: Taci, 1200009E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57916
Homologene: 49320
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: 9330155G14Rik, WI-18508, Nope, WI-16786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56741
VEGA: 9
Homologene: 10570
Ankrd40
Name: ankyrin repeat domain 40
Synonyms: 5530600A18Rik, Gcap15, 1110011C06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71452
Homologene: 12393
B3gnt9
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms: B3gnt9-ps
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97440
Homologene: 13250
Or52z14
Name: olfactory receptor family 52 subfamily Z member 14
Synonyms: GA_x6K02T2PBJ9-6326488-6327450, MOR31-5, Olfr619
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259080
Homologene: 45095
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68047
Homologene: 12231
Ten1
Name: TEN1 telomerase capping complex subunit
Synonyms: 2310004N24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69535
Homologene: 28494
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,533,947 bp
  • T to G, chromosome 1 at 63,633,678 bp
  • T to A, chromosome 1 at 131,154,391 bp
  • C to G, chromosome 1 at 189,851,277 bp
  • A to T, chromosome 2 at 12,396,213 bp
  • T to G, chromosome 2 at 69,105,112 bp
  • T to C, chromosome 2 at 122,296,755 bp
  • A to G, chromosome 2 at 130,741,873 bp
  • A to G, chromosome 2 at 181,028,872 bp
  • A to G, chromosome 3 at 129,711,468 bp
  • A to G, chromosome 3 at 145,938,120 bp
  • T to C, chromosome 3 at 146,747,977 bp
  • A to C, chromosome 4 at 45,803,661 bp
  • A to G, chromosome 4 at 90,224,304 bp
  • T to C, chromosome 4 at 97,720,287 bp
  • T to C, chromosome 4 at 101,909,170 bp
  • T to A, chromosome 5 at 96,636,840 bp
  • A to T, chromosome 5 at 110,379,029 bp
  • A to T, chromosome 5 at 115,082,314 bp
  • A to G, chromosome 5 at 137,291,914 bp
  • C to T, chromosome 5 at 148,077,416 bp
  • G to A, chromosome 6 at 122,707,906 bp
  • G to T, chromosome 6 at 125,307,474 bp
  • G to T, chromosome 6 at 126,836,320 bp
  • A to G, chromosome 7 at 4,133,944 bp
  • A to G, chromosome 7 at 4,471,241 bp
  • G to T, chromosome 7 at 19,579,712 bp
  • A to T, chromosome 7 at 46,197,231 bp
  • A to G, chromosome 7 at 62,380,624 bp
  • T to G, chromosome 7 at 103,604,374 bp
  • A to T, chromosome 7 at 128,204,625 bp
  • G to A, chromosome 7 at 145,267,309 bp
  • A to T, chromosome 8 at 4,103,688 bp
  • T to C, chromosome 8 at 27,394,230 bp
  • T to C, chromosome 8 at 105,254,244 bp
  • C to T, chromosome 8 at 110,816,329 bp
  • A to G, chromosome 8 at 123,368,784 bp
  • A to G, chromosome 9 at 3,759,588 bp
  • A to T, chromosome 9 at 20,137,562 bp
  • A to T, chromosome 9 at 22,258,123 bp
  • T to C, chromosome 9 at 58,069,851 bp
  • A to G, chromosome 9 at 65,124,015 bp
  • T to C, chromosome 9 at 89,601,652 bp
  • C to A, chromosome 9 at 103,228,048 bp
  • G to A, chromosome 9 at 106,433,191 bp
  • A to T, chromosome 11 at 61,140,937 bp
  • T to A, chromosome 11 at 94,334,821 bp
  • G to A, chromosome 11 at 100,050,157 bp
  • C to T, chromosome 11 at 101,468,999 bp
  • T to C, chromosome 11 at 102,481,224 bp
  • T to C, chromosome 11 at 116,205,729 bp
  • G to T, chromosome 12 at 105,222,613 bp
  • A to G, chromosome 13 at 46,809,055 bp
  • T to C, chromosome 13 at 60,760,960 bp
  • G to T, chromosome 14 at 60,228,842 bp
  • A to G, chromosome 14 at 110,750,379 bp
  • T to C, chromosome 15 at 10,492,762 bp
  • T to C, chromosome 15 at 34,083,239 bp
  • A to G, chromosome 15 at 102,305,730 bp
  • T to C, chromosome 16 at 4,861,046 bp
  • T to A, chromosome 16 at 96,437,449 bp
  • A to T, chromosome 17 at 19,811,769 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • T to G, chromosome 17 at 56,012,362 bp
  • A to G, chromosome 18 at 57,934,963 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 19 at 46,071,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4931 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042532-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.