Strain Name:
C57BL/6J-MtgxR4996Btlr/Mmmh
Stock Number:
042590-MU
Citation ID:
RRID:MMRRC_042590-MU
Other Names:
R4996 (G1), C57BL/6J-MtgxR4996Btlr
Major Collection:

Strain Information

Dnajc3
Name: DnaJ heat shock protein family (Hsp40) member C3
Synonyms: p58IPK, mp58, Prkri, Dnajc3, Dnajc3a, Dnajc3b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100037258
VEGA: 14
HGNC: HGNC:9439
Homologene: 2486
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: A-C1, 2810012B06Rik, Hrasls
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27281
Homologene: 8452
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14211
Homologene: 4705
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17776
Homologene: 7428
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Rfx5
Name: regulatory factor X, 5 (influences HLA class II expression)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 53970
HGNC: HGNC:9986
Pgr
Name: progesterone receptor
Synonyms: NR3C3, PR, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: 9130014E20Rik, B130008E12Rik, mSmile
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237500
Homologene: 27616
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Nefm
Name: neurofilament, medium polypeptide
Synonyms: NF160, Nfm, NF-M, NF165, Nef3, neurofilament-M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18040
HGNC: HGNC:7734
Homologene: 137211
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23965
Homologene: 22673
Rmnd5b
Name: required for meiotic nuclear division 5 homolog B
Synonyms: 0610039K22Rik, Gid2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66089
Homologene: 100777
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: DCAL, 1110034F20Rik, Ahcy-rs3, IRBIT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229709
HGNC: HGNC:344
Homologene: 77353
Kdm6b
Name: KDM1 lysine (K)-specific demethylase 6B
Synonyms: Jmjd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216850
Homologene: 18945
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94109
Homologene: 69536
Cript
Name: cysteine-rich PDZ-binding protein
Synonyms: CRIPT, 1200020A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56724
Homologene: 8572
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11988
Homologene: 20659
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320051
Homologene: 9007
Pcdhac1
Name: protocadherin alpha subfamily C, 1
Synonyms: CNRc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 353236
HGNC: HGNC:8676
Homologene: 49561
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Tubgcp6
Name: tubulin, gamma complex associated protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 328580
Homologene: 32477
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330490
Homologene: 116072
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trp3, Trrp3, Trcp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22065
Homologene: 20708
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Insr
Name: insulin receptor
Synonyms: IR, CD220, 4932439J01Rik, D630014A15Rik, IR-B, IR-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68178
Homologene: 41901
Sp140l2
Name: Sp140 nuclear body protein like 2
Synonyms: OTTMUSG00000029174, C130026I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 620078
Homologene: 131208
Fmnl1
Name: formin-like 1
Synonyms: 8030453N10Rik, formin-related gene in leukocytes
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 57778
HGNC: HGNC:1212
Homologene: 135620
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69700
Homologene: 43567
Inhbb
Name: inhibin beta-B
Synonyms: activin beta-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16324
HGNC: HGNC:6067
Homologene: 1654
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224079
Homologene: 75330
Gmpr2
Name: guanosine monophosphate reductase 2
Synonyms: 5730544D12Rik, 1810008P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105446
VEGA: 14
HGNC: HGNC:4377
Homologene: 22983
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 64899
Homologene: 84844
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54563
Homologene: 41286
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Ppm1h
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: ARHCL1, A430075L18Rik, C030002B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319468
Homologene: 18537
Pdhx
Name: pyruvate dehydrogenase complex, component X
Synonyms: Pdx1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27402
Homologene: 55757
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67722
Homologene: 69412
Vmn1r64
Name: vomeronasal 1 receptor 64
Synonyms: V1rd11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404285
Homologene: 41799
Sox5
Name: SRY (sex determining region Y)-box 5
Synonyms: A730017D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20678
Homologene: 21378
Lrrc8e
Name: leucine rich repeat containing 8 family, member E
Synonyms: C87354, 1810049O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72267
Homologene: 11817
Slc15a5
Name: solute carrier family 15, member 5
Synonyms: 9830102E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 277898
Homologene: 65333
Pnpt1
Name: polyribonucleotide nucleotidyltransferase 1
Synonyms: PNPase, polynucleotide phosphorylase, 1200003F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71701
Homologene: 12404
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 434285
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: pheromone recepter, EC1-VR2, V2rf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216144
Homologene: 83483
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71519
Homologene: 77704
4930505A04Rik
Name: RIKEN cDNA 4930505A04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75087
Homologene: 18988
Gm960
Name: predicted gene 960
Synonyms: Top6bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381196
VEGA: 19
Homologene: 69381
Cd163
Name: CD163 antigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93671
HGNC: HGNC:1631
Homologene: 128811
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Or1o3
Name: olfactory receptor family 1 subfamily O member 3
Synonyms: MOR156-4, GA_x6K02T2PSCP-1703582-1702653, Olfr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258503
Homologene: 133051
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209462
Homologene: 10807
Ift70a1
Name: intraflagellar transport 70A1
Synonyms: 4930506L13Rik, Ttc30a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78802
Homologene: 136638
Calml3
Name: calmodulin-like 3
Synonyms: 2310068O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 70405
VEGA: 13
HGNC: HGNC:1452
Homologene: 133078
Capn10
Name: calpain 10
Synonyms: Capn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23830
HGNC: HGNC:1477
Homologene: 36323
Relb
Name: avian reticuloendotheliosis viral (v-rel) oncogene related B
Synonyms: shep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19698
HGNC: HGNC:9956
Homologene: 4747
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76524
HGNC: HGNC:2077
Homologene: 9898
Drp2
Name: dystrophin related protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13497
HGNC: HGNC:3032
Homologene: 55620
Alg9
Name: asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Synonyms: 8230402H15Rik, B430313H07Rik, Dibd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102580
Homologene: 6756
Asb14
Name: ankyrin repeat and SOCS box-containing 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 142687
Homologene: 15445
Micall2
Name: MICAL-like 2
Synonyms: Jrab, MICAL-L2, A930021H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231830
Homologene: 85155
Or3a1c
Name: olfactory receptor family 3 subfamily A member 1C
Synonyms: GA_x6K02T2P1NL-4307199-4308146, MOR255-4, Olfr402
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258703
HGNC: HGNC:8282
Homologene: 1915
Or8k32
Name: olfactory receptor family 8 subfamily K member 32
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1, Olfr1079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258402
Homologene: 74090
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: WIP, D2Ertd120e, Waspip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215280
Homologene: 86891
Akr1cl
Name: aldo-keto reductase family 1, member C-like
Synonyms: 4921521F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70861
Homologene: 133861
Efhd1
Name: EF hand domain containing 1
Synonyms: PP3051, 4931430I01Rik, mitocalcin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98363
Homologene: 41618
Pex11b
Name: peroxisomal biogenesis factor 11 beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18632
HGNC: HGNC:8853
Homologene: 2852
Ccnl2
Name: cyclin L2
Synonyms: 1810019L15Rik, ania-6b, Pcee, 1700010A01Rik, 2010319M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56036
Homologene: 69477
Tor3a
Name: torsin family 3, member A
Synonyms: Adir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 30935
Homologene: 23359
Gm15956
Name: predicted gene 15956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Rgcc
Name: regulator of cell cycle
Synonyms: RGC-32, 1190002H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66214
Homologene: 8544
C030037F17Rik
Name: RIKEN cDNA C030037F17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 77475
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100042781
Homologene: 113703
2810425M01Rik
Name: RIKEN cDNA 2810425M01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 69972
VEGA: 10
Frs3os
Name: fibroblast growth factor receptor substrate 3, opposite strand
Synonyms: Gm14873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100126242
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 65,016,264 bp
  • G to T, chromosome 1 at 85,247,094 bp
  • G to T, chromosome 1 at 87,264,558 bp
  • A to G, chromosome 1 at 92,945,136 bp
  • A to C, chromosome 1 at 119,420,818 bp
  • A to T, chromosome 1 at 135,465,971 bp
  • T to C, chromosome 1 at 156,655,772 bp
  • GCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCC, chromosome 2 at 73,440,074 bp
  • C to T, chromosome 2 at 75,979,922 bp
  • T to C, chromosome 2 at 86,538,271 bp
  • T to C, chromosome 2 at 103,030,312 bp
  • T to A, chromosome 2 at 160,905,287 bp
  • T to C, chromosome 3 at 36,662,818 bp
  • A to G, chromosome 3 at 80,707,141 bp
  • G to A, chromosome 3 at 94,955,815 bp
  • T to C, chromosome 3 at 96,643,809 bp
  • A to T, chromosome 3 at 107,668,287 bp
  • T to A, chromosome 3 at 131,298,284 bp
  • T to A, chromosome 4 at 52,461,042 bp
  • T to C, chromosome 4 at 116,430,502 bp
  • T to A, chromosome 4 at 155,813,524 bp
  • A to G, chromosome 5 at 139,710,589 bp
  • A to T, chromosome 6 at 91,053,436 bp
  • A to T, chromosome 6 at 91,266,010 bp
  • A to G, chromosome 6 at 124,319,147 bp
  • G to A, chromosome 6 at 138,043,585 bp
  • A to T, chromosome 6 at 144,028,344 bp
  • T to A, chromosome 7 at 5,884,053 bp
  • T to A, chromosome 7 at 8,908,167 bp
  • A to T, chromosome 7 at 19,615,603 bp
  • A to T, chromosome 7 at 26,385,747 bp
  • C to A, chromosome 7 at 46,298,606 bp
  • C to A, chromosome 7 at 46,305,510 bp
  • C to T, chromosome 8 at 3,192,665 bp
  • C to T, chromosome 8 at 4,235,166 bp
  • A to G, chromosome 8 at 14,745,492 bp
  • A to T, chromosome 8 at 15,042,166 bp
  • A to T, chromosome 8 at 15,910,452 bp
  • A to T, chromosome 8 at 40,912,562 bp
  • A to T, chromosome 8 at 48,235,826 bp
  • C to A, chromosome 9 at 8,900,913 bp
  • T to C, chromosome 9 at 50,808,705 bp
  • G to C, chromosome 9 at 53,375,610 bp
  • A to T, chromosome 9 at 53,524,507 bp
  • T to A, chromosome 9 at 62,850,655 bp
  • CTTGCCCAGGTT to CTT, chromosome 9 at 71,724,826 bp
  • A to G, chromosome 9 at 107,931,735 bp
  • T to G, chromosome 9 at 119,146,050 bp
  • G to A, chromosome 10 at 45,649,950 bp
  • A to T, chromosome 10 at 77,515,533 bp
  • A to T, chromosome 10 at 79,293,413 bp
  • A to T, chromosome 10 at 100,447,224 bp
  • A to T, chromosome 10 at 122,941,340 bp
  • C to T, chromosome 10 at 128,042,429 bp
  • A to G, chromosome 11 at 29,147,505 bp
  • C to T, chromosome 11 at 30,426,349 bp
  • A to G, chromosome 11 at 51,627,908 bp
  • G to T, chromosome 11 at 69,405,731 bp
  • A to G, chromosome 11 at 74,155,331 bp
  • G to A, chromosome 11 at 103,182,656 bp
  • A to G, chromosome 12 at 75,943,950 bp
  • T to C, chromosome 13 at 3,804,142 bp
  • G to A, chromosome 13 at 43,425,094 bp
  • T to C, chromosome 13 at 81,578,734 bp
  • C to A, chromosome 13 at 112,356,088 bp
  • A to G, chromosome 14 at 26,912,116 bp
  • T to C, chromosome 14 at 55,676,795 bp
  • T to C, chromosome 14 at 68,121,121 bp
  • T to C, chromosome 14 at 79,290,276 bp
  • A to G, chromosome 14 at 118,972,427 bp
  • T to C, chromosome 15 at 59,333,635 bp
  • A to C, chromosome 15 at 72,007,161 bp
  • A to T, chromosome 15 at 89,103,490 bp
  • G to A, chromosome 16 at 29,217,704 bp
  • A to T, chromosome 16 at 29,472,004 bp
  • A to G, chromosome 17 at 37,262,867 bp
  • A to G, chromosome 17 at 47,701,710 bp
  • A to G, chromosome 17 at 87,027,790 bp
  • A to G, chromosome 18 at 12,198,565 bp
  • T to C, chromosome 18 at 12,518,743 bp
  • C to T, chromosome 18 at 37,092,527 bp
  • A to G, chromosome 19 at 3,473,833 bp
  • T to A, chromosome 19 at 4,626,084 bp
  • G to A, chromosome X at 134,441,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4996 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042590-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.