Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4996Btlr/Mmmh
Stock Number:
042590-MU
Citation ID:
RRID:MMRRC_042590-MU
Other Names:
R4996 (G1), C57BL/6J-MtgxR4996Btlr
Major Collection:

Strain Information

Dnajc3
Name: DnaJ heat shock protein family (Hsp40) member C3
Synonyms: p58IPK, mp58, Prkri, Dnajc3, Dnajc3a, Dnajc3b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100037258
VEGA: 14
HGNC: HGNC:9439
Homologene: 2486
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: A-C1, 2810012B06Rik, Hrasls
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27281
Homologene: 8452
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 65,016,264 bp
  • G to T, chromosome 1 at 85,247,094 bp
  • G to T, chromosome 1 at 87,264,558 bp
  • A to G, chromosome 1 at 92,945,136 bp
  • A to C, chromosome 1 at 119,420,818 bp
  • A to T, chromosome 1 at 135,465,971 bp
  • T to C, chromosome 1 at 156,655,772 bp
  • GCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCC, chromosome 2 at 73,440,074 bp
  • C to T, chromosome 2 at 75,979,922 bp
  • T to C, chromosome 2 at 86,538,271 bp
  • T to C, chromosome 2 at 103,030,312 bp
  • T to A, chromosome 2 at 160,905,287 bp
  • T to C, chromosome 3 at 36,662,818 bp
  • A to G, chromosome 3 at 80,707,141 bp
  • G to A, chromosome 3 at 94,955,815 bp
  • T to C, chromosome 3 at 96,643,809 bp
  • A to T, chromosome 3 at 107,668,287 bp
  • T to A, chromosome 3 at 131,298,284 bp
  • T to A, chromosome 4 at 52,461,042 bp
  • T to C, chromosome 4 at 116,430,502 bp
  • T to A, chromosome 4 at 155,813,524 bp
  • A to G, chromosome 5 at 139,710,589 bp
  • A to T, chromosome 6 at 91,053,436 bp
  • A to T, chromosome 6 at 91,266,010 bp
  • A to G, chromosome 6 at 124,319,147 bp
  • G to A, chromosome 6 at 138,043,585 bp
  • A to T, chromosome 6 at 144,028,344 bp
  • T to A, chromosome 7 at 5,884,053 bp
  • T to A, chromosome 7 at 8,908,167 bp
  • A to T, chromosome 7 at 19,615,603 bp
  • A to T, chromosome 7 at 26,385,747 bp
  • C to A, chromosome 7 at 46,298,606 bp
  • C to A, chromosome 7 at 46,305,510 bp
  • C to T, chromosome 8 at 3,192,665 bp
  • C to T, chromosome 8 at 4,235,166 bp
  • A to G, chromosome 8 at 14,745,492 bp
  • A to T, chromosome 8 at 15,042,166 bp
  • A to T, chromosome 8 at 15,910,452 bp
  • A to T, chromosome 8 at 40,912,562 bp
  • A to T, chromosome 8 at 48,235,826 bp
  • C to A, chromosome 9 at 8,900,913 bp
  • T to C, chromosome 9 at 50,808,705 bp
  • G to C, chromosome 9 at 53,375,610 bp
  • A to T, chromosome 9 at 53,524,507 bp
  • T to A, chromosome 9 at 62,850,655 bp
  • CTTGCCCAGGTT to CTT, chromosome 9 at 71,724,826 bp
  • A to G, chromosome 9 at 107,931,735 bp
  • T to G, chromosome 9 at 119,146,050 bp
  • G to A, chromosome 10 at 45,649,950 bp
  • A to T, chromosome 10 at 77,515,533 bp
  • A to T, chromosome 10 at 79,293,413 bp
  • A to T, chromosome 10 at 100,447,224 bp
  • A to T, chromosome 10 at 122,941,340 bp
  • C to T, chromosome 10 at 128,042,429 bp
  • A to G, chromosome 11 at 29,147,505 bp
  • C to T, chromosome 11 at 30,426,349 bp
  • A to G, chromosome 11 at 51,627,908 bp
  • G to T, chromosome 11 at 69,405,731 bp
  • A to G, chromosome 11 at 74,155,331 bp
  • G to A, chromosome 11 at 103,182,656 bp
  • A to G, chromosome 12 at 75,943,950 bp
  • T to C, chromosome 13 at 3,804,142 bp
  • G to A, chromosome 13 at 43,425,094 bp
  • T to C, chromosome 13 at 81,578,734 bp
  • C to A, chromosome 13 at 112,356,088 bp
  • A to G, chromosome 14 at 26,912,116 bp
  • T to C, chromosome 14 at 55,676,795 bp
  • T to C, chromosome 14 at 68,121,121 bp
  • T to C, chromosome 14 at 79,290,276 bp
  • A to G, chromosome 14 at 118,972,427 bp
  • T to C, chromosome 15 at 59,333,635 bp
  • A to C, chromosome 15 at 72,007,161 bp
  • A to T, chromosome 15 at 89,103,490 bp
  • G to A, chromosome 16 at 29,217,704 bp
  • A to T, chromosome 16 at 29,472,004 bp
  • A to G, chromosome 17 at 37,262,867 bp
  • A to G, chromosome 17 at 47,701,710 bp
  • A to G, chromosome 17 at 87,027,790 bp
  • A to G, chromosome 18 at 12,198,565 bp
  • T to C, chromosome 18 at 12,518,743 bp
  • C to T, chromosome 18 at 37,092,527 bp
  • A to G, chromosome 19 at 3,473,833 bp
  • T to A, chromosome 19 at 4,626,084 bp
  • G to A, chromosome X at 134,441,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4996 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042590-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.