Strain Name:
C57BL/6J-MtgxR4996Btlr/Mmmh
Stock Number:
042590-MU
Citation ID:
RRID:MMRRC_042590-MU
Other Names:
R4996 (G1), C57BL/6J-MtgxR4996Btlr
Major Collection:

Gene Information

Dnajc3
Name: DnaJ heat shock protein family (Hsp40) member C3
Synonyms: Dnajc3, Prkri, Dnajc3a, Dnajc3b, p58IPK, mp58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 100037258
VEGA: 14
HGNC: HGNC:9439
Homologene: 2486
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: Glur2, Glur-2, GluR2, GluA2, GluR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 14800
VEGA: 3
HGNC: HGNC:4572
Homologene: 20225
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: Hrasls, 2810012B06Rik, A-C1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 27281
VEGA: 16
Homologene: 8452
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 11920
VEGA: 9
HGNC: HGNC:795
Homologene: 30952
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: CAP-E, 5730502P04Rik, Smc2l1, Fin16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 14211
VEGA: 4
Homologene: 4705
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: Mtssk, MAST205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 17776
VEGA: 4
Homologene: 7428
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: Saps3, 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, Pp6r3, Pptcs3, D19Ertd703e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 56705
VEGA: 13
Homologene: 38057
Rfx5
Name: regulatory factor X, 5 (influences HLA class II expression)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 53970
VEGA: 3
HGNC: HGNC:9986
Pgr
Name: progesterone receptor
Synonyms: ENSMUSG00000074510, 9930019P03Rik, PR-B, NR3C3, PR-A, PR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 18667
VEGA: 9
HGNC: HGNC:8910
Homologene: 713
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: B130008E12Rik, mSmile, 9130014E20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237500
VEGA: 10
Homologene: 27616
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Nefm
Name: neurofilament, medium polypeptide
Synonyms: Nef3, NF-M, NF160, Nfm, NF165, neurofilament-M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 18040
VEGA: 14
HGNC: HGNC:7734
Homologene: 137211
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, Odz3, 2610100B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 23965
VEGA: 8
Homologene: 22673
Rmnd5b
Name: required for meiotic nuclear division 5 homolog B
Synonyms: 0610039K22Rik, Gid2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 66089
VEGA: 11
Homologene: 100777
Nav1
Name: neuron navigator 1
Synonyms: C230080M11Rik, steerin-1, POMFIL3, unc53H1, 9930003A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 215690
VEGA: 1
Homologene: 10719
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: 1110034F20Rik, IRBIT, Ahcy-rs3, DCAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229709
VEGA: 3
HGNC: HGNC:344
Homologene: 77353
Kdm6b
Name: KDM1 lysine (K)-specific demethylase 6B
Synonyms: Jmjd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216850
VEGA: 11
Homologene: 18945
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223593
VEGA: 15
Homologene: 8898
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 94109
VEGA: 8
Homologene: 69536
Cript
Name: cysteine-rich PDZ-binding protein
Synonyms: CRIPT, 1200020A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 56724
VEGA: 17
Homologene: 8572
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Cat2, Atrc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 11988
VEGA: 8
Homologene: 20659
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, Nesp2g, nesprin-2, syne-2, dice, Cpfl8, 6820443O06Rik, diminished cone electroretinogram
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 319565
VEGA: 12
Homologene: 56700
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320051
VEGA: 9
Homologene: 9007
Pcdhac1
Name: protocadherin alpha subfamily C, 1
Synonyms: CNRc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 353236
VEGA: 18
HGNC: HGNC:8676
Homologene: 49561
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 16774
VEGA: 18
HGNC: HGNC:6483
Homologene: 18279
Tubgcp6
Name: tubulin, gamma complex associated protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 328580
VEGA: 15
Homologene: 32477
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mgr1, Mass1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110789
VEGA: 13
Homologene: 19815
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp-zeta, Nalp9c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 330490
VEGA: 7
Homologene: 116072
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trcp3, Trrp3, Trp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 22065
VEGA: 3
Homologene: 20708
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18419
VEGA: 7
HGNC: HGNC:8516
Homologene: 8421
Insr
Name: insulin receptor
Synonyms: IR, IR-B, D630014A15Rik, 4932439J01Rik, CD220, IR-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16337
VEGA: 8
HGNC: HGNC:6091
Homologene: 20090
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 68178
VEGA: 9
Homologene: 41901
C130026I21Rik
Name: RIKEN cDNA C130026I21 gene
Synonyms: OTTMUSG00000029174
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 620078
VEGA: 1
Homologene: 131208
Fmnl1
Name: formin-like 1
Synonyms: formin-related gene in leukocytes, 8030453N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 57778
VEGA: 11
HGNC: HGNC:1212
Homologene: 135620
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 69700
VEGA: 15
Homologene: 43567
Inhbb
Name: inhibin beta-B
Synonyms: activin beta-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16324
VEGA: 1
HGNC: HGNC:6067
Homologene: 1654
Atp13a4
Name: ATPase type 13A4
Synonyms: 9330174J19Rik, 4631413J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224079
VEGA: 16
Homologene: 75330
Gmpr2
Name: guanosine monophosphate reductase 2
Synonyms: 1810008P16Rik, 5730544D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105446
VEGA: 14
HGNC: HGNC:4377
Homologene: 22983
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 64899
VEGA: 2
Homologene: 84844
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 54563
VEGA: 6
Homologene: 41286
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14115
VEGA: 6
HGNC: HGNC:3601
Homologene: 1514
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320256
VEGA: 9
HGNC: HGNC:2899
Homologene: 84733
Ppm1h
Name: protein phosphatase 1H (PP2C domain containing)
Synonyms: C030002B11Rik, ARHCL1, A430075L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 319468
VEGA: 10
Homologene: 18537
Pdhx
Name: pyruvate dehydrogenase complex, component X
Synonyms: Pdx1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27402
VEGA: 2
Homologene: 55757
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 67722
VEGA: 9
Homologene: 69412
Vmn1r64
Name: vomeronasal 1 receptor 64
Synonyms: V1rd11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 404285
VEGA: 7
Homologene: 41799
Sox5
Name: SRY (sex determining region Y)-box 5
Synonyms: A730017D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20678
VEGA: 6
Homologene: 21378
Lrrc8e
Name: leucine rich repeat containing 8 family, member E
Synonyms: 1810049O03Rik, C87354
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72267
VEGA: 8
Homologene: 11817
Slc15a5
Name: solute carrier family 15, member 5
Synonyms: 9830102E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 277898
VEGA: 6
Homologene: 65333
Pnpt1
Name: polyribonucleotide nucleotidyltransferase 1
Synonyms: polynucleotide phosphorylase, 1200003F12Rik, PNPase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71701
VEGA: 11
Homologene: 12404
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 434285
VEGA: 8
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: V2rf2, pheromone recepter, EC1-VR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216144
VEGA: 10
Homologene: 83483
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 71519
VEGA: 3
Homologene: 77704
4930505A04Rik
Name: RIKEN cDNA 4930505A04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 75087
VEGA: 11
Homologene: 18988
Gm960
Name: predicted gene 960
Synonyms: Top6bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 381196
VEGA: 19
Homologene: 69381
Cd163
Name: CD163 antigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 93671
VEGA: 6
HGNC: HGNC:1631
Homologene: 128811
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 77318
VEGA: 13
Homologene: 12674
Olfr98
Name: olfactory receptor 98
Synonyms: MOR156-4, GA_x6K02T2PSCP-1703582-1702653
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 258503
VEGA: 17
Homologene: 133051
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: 1700042J16Rik, A730034A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 209462
VEGA: 10
Homologene: 10807
Ttc30a1
Name: tetratricopeptide repeat domain 30A1
Synonyms: 4930506L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 78802
VEGA: 2
Homologene: 136638
Calml3
Name: calmodulin-like 3
Synonyms: 2310068O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 70405
VEGA: 13
HGNC: HGNC:1452
Homologene: 133078
Capn10
Name: calpain 10
Synonyms: Capn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 23830
VEGA: 1
HGNC: HGNC:1477
Homologene: 36323
Relb
Name: avian reticuloendotheliosis viral (v-rel) oncogene related B
Synonyms: shep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19698
VEGA: 7
HGNC: HGNC:9956
Homologene: 4747
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 76524
VEGA: 9
HGNC: HGNC:2077
Homologene: 9898
Drp2
Name: dystrophin related protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 13497
VEGA: X
HGNC: HGNC:3032
Homologene: 55620
Alg9
Name: asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Synonyms: 8230402H15Rik, Dibd1, B430313H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 102580
VEGA: 9
Homologene: 6756
Asb14
Name: ankyrin repeat and SOCS box-containing 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 142687
VEGA: 14
Homologene: 15445
Micall2
Name: MICAL-like 2
Synonyms: Jrab, A930021H16Rik, MICAL-L2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231830
VEGA: 5
Homologene: 85155
Olfr402
Name: olfactory receptor 402
Synonyms: MOR255-4, GA_x6K02T2P1NL-4307199-4308146
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258703
VEGA: 11
HGNC: HGNC:8282
Homologene: 1915
Olfr1079
Name: olfactory receptor 1079
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258402
VEGA: 2
Homologene: 74090
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: WIP, D2Ertd120e, Waspip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 215280
VEGA: 2
Homologene: 86891
Akr1cl
Name: aldo-keto reductase family 1, member C-like
Synonyms: 4921521F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70861
VEGA: 1
Homologene: 133861
Efhd1
Name: EF hand domain containing 1
Synonyms: mitocalcin, 4931430I01Rik, PP3051
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98363
VEGA: 1
Homologene: 41618
Pex11b
Name: peroxisomal biogenesis factor 11 beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18632
VEGA: 3
HGNC: HGNC:8853
Homologene: 2852
Ccnl2
Name: cyclin L2
Synonyms: ania-6b, Pcee, 1700010A01Rik, 2010319M22Rik, 1810019L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56036
VEGA: 4
Homologene: 69477
Tor3a
Name: torsin family 3, member A
Synonyms: Adir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 30935
VEGA: 1
Homologene: 23359
Gm15956
Name: predicted gene 15956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
Rgcc
Name: regulator of cell cycle
Synonyms: RGC-32, 1190002H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 66214
VEGA: 14
Homologene: 8544
C030037F17Rik
Name: RIKEN cDNA C030037F17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 77475
VEGA: 8
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100042781
VEGA: 7
Homologene: 113703
2810425M01Rik
Name: RIKEN cDNA 2810425M01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
VEGA: 10
Frs3os
Name: fibroblast growth factor receptor substrate 3, opposite strand
Synonyms: Gm14873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 100126242
VEGA: 17
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 65,016,264 bp
  • G to T, chromosome 1 at 85,247,094 bp
  • G to T, chromosome 1 at 87,264,558 bp
  • A to G, chromosome 1 at 92,945,136 bp
  • A to C, chromosome 1 at 119,420,818 bp
  • A to T, chromosome 1 at 135,465,971 bp
  • T to C, chromosome 1 at 156,655,772 bp
  • GCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCC, chromosome 2 at 73,440,074 bp
  • C to T, chromosome 2 at 75,979,922 bp
  • T to C, chromosome 2 at 86,538,271 bp
  • T to C, chromosome 2 at 103,030,312 bp
  • T to A, chromosome 2 at 160,905,287 bp
  • T to C, chromosome 3 at 36,662,818 bp
  • A to G, chromosome 3 at 80,707,141 bp
  • G to A, chromosome 3 at 94,955,815 bp
  • T to C, chromosome 3 at 96,643,809 bp
  • A to T, chromosome 3 at 107,668,287 bp
  • T to A, chromosome 3 at 131,298,284 bp
  • T to A, chromosome 4 at 52,461,042 bp
  • T to C, chromosome 4 at 116,430,502 bp
  • T to A, chromosome 4 at 155,813,524 bp
  • A to G, chromosome 5 at 139,710,589 bp
  • A to T, chromosome 6 at 91,053,436 bp
  • A to T, chromosome 6 at 91,266,010 bp
  • A to G, chromosome 6 at 124,319,147 bp
  • G to A, chromosome 6 at 138,043,585 bp
  • A to T, chromosome 6 at 144,028,344 bp
  • T to A, chromosome 7 at 5,884,053 bp
  • T to A, chromosome 7 at 8,908,167 bp
  • A to T, chromosome 7 at 19,615,603 bp
  • A to T, chromosome 7 at 26,385,747 bp
  • C to A, chromosome 7 at 46,298,606 bp
  • C to A, chromosome 7 at 46,305,510 bp
  • C to T, chromosome 8 at 3,192,665 bp
  • C to T, chromosome 8 at 4,235,166 bp
  • A to G, chromosome 8 at 14,745,492 bp
  • A to T, chromosome 8 at 15,042,166 bp
  • A to T, chromosome 8 at 15,910,452 bp
  • A to T, chromosome 8 at 40,912,562 bp
  • A to T, chromosome 8 at 48,235,826 bp
  • C to A, chromosome 9 at 8,900,913 bp
  • T to C, chromosome 9 at 50,808,705 bp
  • G to C, chromosome 9 at 53,375,610 bp
  • A to T, chromosome 9 at 53,524,507 bp
  • T to A, chromosome 9 at 62,850,655 bp
  • CTTGCCCAGGTT to CTT, chromosome 9 at 71,724,826 bp
  • A to G, chromosome 9 at 107,931,735 bp
  • T to G, chromosome 9 at 119,146,050 bp
  • G to A, chromosome 10 at 45,649,950 bp
  • A to T, chromosome 10 at 77,515,533 bp
  • A to T, chromosome 10 at 79,293,413 bp
  • A to T, chromosome 10 at 100,447,224 bp
  • A to T, chromosome 10 at 122,941,340 bp
  • C to T, chromosome 10 at 128,042,429 bp
  • A to G, chromosome 11 at 29,147,505 bp
  • C to T, chromosome 11 at 30,426,349 bp
  • A to G, chromosome 11 at 51,627,908 bp
  • G to T, chromosome 11 at 69,405,731 bp
  • A to G, chromosome 11 at 74,155,331 bp
  • G to A, chromosome 11 at 103,182,656 bp
  • A to G, chromosome 12 at 75,943,950 bp
  • T to C, chromosome 13 at 3,804,142 bp
  • G to A, chromosome 13 at 43,425,094 bp
  • T to C, chromosome 13 at 81,578,734 bp
  • C to A, chromosome 13 at 112,356,088 bp
  • A to G, chromosome 14 at 26,912,116 bp
  • T to C, chromosome 14 at 55,676,795 bp
  • T to C, chromosome 14 at 68,121,121 bp
  • T to C, chromosome 14 at 79,290,276 bp
  • A to G, chromosome 14 at 118,972,427 bp
  • T to C, chromosome 15 at 59,333,635 bp
  • A to C, chromosome 15 at 72,007,161 bp
  • A to T, chromosome 15 at 89,103,490 bp
  • G to A, chromosome 16 at 29,217,704 bp
  • A to T, chromosome 16 at 29,472,004 bp
  • A to G, chromosome 17 at 37,262,867 bp
  • A to G, chromosome 17 at 47,701,710 bp
  • A to G, chromosome 17 at 87,027,790 bp
  • A to G, chromosome 18 at 12,198,565 bp
  • T to C, chromosome 18 at 12,518,743 bp
  • C to T, chromosome 18 at 37,092,527 bp
  • A to G, chromosome 19 at 3,473,833 bp
  • T to A, chromosome 19 at 4,626,084 bp
  • G to A, chromosome X at 134,441,316 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4996 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042590-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.