Strain Name:
C57BL/6J-MtgxR5041Btlr/Mmmh
Stock Number:
042631-MU
Citation ID:
RRID:MMRRC_042631-MU
Other Names:
R5041 (G1), C57BL/6J-MtgxR5041Btlr
Major Collection:

Strain Information

Becn1
Name: beclin 1, autophagy related
Synonyms: Atg6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56208
HGNC: HGNC:1034
Homologene: 2794
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, trabeculin alpha, Acf7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Usp28
Name: ubiquitin specific peptidase 28
Synonyms: 9830148O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235323
VEGA: 9
Homologene: 10840
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: LOC383951, 2310020L09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Ddx56
Name: DEAD box helicase 56
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 56, NOH61, 2600001H07Rik, D11Ertd619e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52513
Homologene: 6498
Supt5
Name: suppressor of Ty 5, DSIF elongation factor subunit
Synonyms: Spt5, Supt5h
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20924
Homologene: 2384
Rsf1
Name: remodeling and spacing factor 1
Synonyms: Hbxap, p325, XAP8, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: 2810449H11Rik, D130015N03Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Ap3s2
Name: adaptor-related protein complex 3, sigma 2 subunit
Synonyms: [s]3B, sigma 3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11778
HGNC: HGNC:571
Homologene: 100592
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: E-NCAM, NCAM-180, NCAM-140, CD56, NCAM-120, NCAM-1, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Anxa11
Name: annexin A11
Synonyms: A830099O17Rik, Anx11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11744
HGNC: HGNC:535
Homologene: 22759
Yy1
Name: YY1 transcription factor
Synonyms: UCRBP transcription factor, NF-E1, delta transcription factor, Yin Yang 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Ddx3y
Name: DEAD box helicase 3, Y-linked
Synonyms: D1Pas1-rs1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked, Dby, 8030469F12Rik
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 26900
HGNC: HGNC:2699
Homologene: 55839
Tent4b
Name: terminal nucleotidyltransferase 4B
Synonyms: Papd5, 5730445M16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 214627
Homologene: 64245
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), DEC1, cytokine response gene 8, Stra13, CR8, Bhlhb2, Clast5, C130042M06Rik, Sharp2, Stra14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Htr7
Name: 5-hydroxytryptamine (serotonin) receptor 7
Synonyms: 5-HT7
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15566
HGNC: HGNC:5302
Homologene: 20244
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: RGC2, A230067G21Rik, AS250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Sstr1
Name: somatostatin receptor 1
Synonyms: sst1, Smstr-1, Smstr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20605
Homologene: 820
Rubcnl
Name: RUN and cysteine rich domain containing beclin 1 interacting protein like
Synonyms: 5031414D18Rik, LOC380917
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271221
VEGA: 14
Homologene: 57021
Atxn7
Name: ataxin 7
Synonyms: A430107N12Rik, ataxin-7, Sca7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246103
VEGA: 14
Homologene: 30967
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Pramel25
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194227
Homologene: 103830
Frmpd1
Name: FERM and PDZ domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666060
Homologene: 8939
Ly6g6c
Name: lymphocyte antigen 6 family member G6C
Synonyms: 1110003M04Rik, NG24, G6c
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68468
Homologene: 11350
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Spmap2l
Name: sperm microtubule associated protein 2 like
Synonyms: Thegl, 1700023E05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71868
Homologene: 128474
Cpxm1
Name: carboxypeptidase X, M14 family member 1
Synonyms: Cpx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56264
Homologene: 10485
Or4c113
Name: olfactory receptor family 4 subfamily C member 113
Synonyms: Olfr1218, GA_x6K02T2Q125-50536041-50535106, MOR233-12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258815
Homologene: 73986
Ctnna2
Name: catenin alpha 2
Synonyms: chp, catenin (cadherin associated protein), alpha 2, alpha N-catenin, Catna, Catna2, alpha(N)-catenin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259172
Homologene: 12866
Or51h7
Name: olfactory receptor family 51 subfamily H member 7
Synonyms: MOR10-3P, Olfr573, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258230
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Spns3
Name: SPNS lysolipid transporter 3, sphingosine-1-phosphate (putative)
Synonyms: 9830002I17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77577
Homologene: 45648
Gimap8
Name: GTPase, IMAP family member 8
Synonyms: LOC243374, IAN9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243374
Homologene: 69703
Tgfb2
Name: transforming growth factor, beta 2
Synonyms: Tgf-beta2, Tgfb-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21808
Homologene: 2432
Vmn2r43
Name: vomeronasal 2, receptor 43
Synonyms: EC2-V2R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381838
Homologene: 113703
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 179,605,028 bp
  • G to A, chromosome 1 at 186,630,675 bp
  • A to T, chromosome 2 at 89,054,921 bp
  • A to G, chromosome 2 at 130,394,070 bp
  • T to C, chromosome 2 at 146,485,151 bp
  • A to T, chromosome 3 at 123,294,231 bp
  • T to A, chromosome 4 at 43,237,836 bp
  • T to G, chromosome 4 at 45,278,878 bp
  • A to G, chromosome 4 at 63,387,144 bp
  • T to C, chromosome 4 at 123,397,046 bp
  • T to C, chromosome 4 at 143,793,690 bp
  • A to G, chromosome 5 at 77,056,081 bp
  • A to G, chromosome 6 at 48,659,163 bp
  • T to A, chromosome 6 at 76,915,763 bp
  • C to T, chromosome 6 at 108,662,585 bp
  • T to C, chromosome 7 at 8,244,807 bp
  • A to T, chromosome 7 at 28,315,380 bp
  • T to C, chromosome 7 at 79,920,519 bp
  • G to A, chromosome 7 at 92,658,405 bp
  • GCGGCGGCG to GCGGCGGCGTCGGCGGCG, chromosome 7 at 97,579,925 bp
  • T to C, chromosome 7 at 102,942,578 bp
  • T to C, chromosome 8 at 72,705,055 bp
  • CCCAACAACGCCAACAA to CCCAACAA, chromosome 8 at 88,255,250 bp
  • T to C, chromosome 9 at 39,600,598 bp
  • A to G, chromosome 9 at 44,102,278 bp
  • A to G, chromosome 9 at 49,037,773 bp
  • T to C, chromosome 9 at 49,566,785 bp
  • T to A, chromosome 9 at 66,429,045 bp
  • A to G, chromosome 11 at 6,264,178 bp
  • G to T, chromosome 11 at 72,536,547 bp
  • A to T, chromosome 11 at 101,288,836 bp
  • T to C, chromosome 12 at 58,213,155 bp
  • TCACCACCACCACCACCACCACCACCACC to TCACCACCACCACCACCACCACCACCACCACC, chromosome 12 at 108,793,631 bp
  • T to C, chromosome 14 at 14,096,317 bp
  • G to T, chromosome 14 at 25,874,764 bp
  • T to C, chromosome 14 at 75,050,132 bp
  • A to G, chromosome 16 at 56,730,348 bp
  • T to A, chromosome 17 at 35,065,452 bp
  • A to C, chromosome 19 at 36,057,067 bp
  • T to A, chromosome Y at 1,266,611 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5041 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042631-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.