Strain Name:
C57BL/6J-MtgxR5206Btlr/Mmmh
Stock Number:
042781-MU
Citation ID:
RRID:MMRRC_042781-MU
Other Names:
R5206 (G1), C57BL/6J-MtgxR5206Btlr
Major Collection:

Strain Information

Xrcc1
Name: X-ray repair complementing defective repair in Chinese hamster cells 1
Synonyms: Xrcc-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22594
Homologene: 31368
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 2610510B01Rik, 0610038M01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Dock5
Name: dedicator of cytokinesis 5
Synonyms: rlc, 1110060D06Rik, lr2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, D430004D17Rik, hnRNP P2, Tls, pigpen, D930039C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Vasp
Name: vasodilator-stimulated phosphoprotein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22323
Homologene: 7592
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72656
Homologene: 9888
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Slc38a10
Name: solute carrier family 38, member 10
Synonyms: 1810073N04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72055
Homologene: 41556
Trim39
Name: tripartite motif-containing 39
Synonyms: tfp, E130103K13Rik, RING-B box-coiled-coil-B30.2, 1100001D15Rik, Rnf23, RBCC-B30.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 79263
Homologene: 10940
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: BetaIl3, Il3r, Il3rb2, Bil3, AIC2A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Zfp219
Name: zinc finger protein 219
Synonyms: 2010302A17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69890
VEGA: 14
Homologene: 9504
Med13
Name: mediator complex subunit 13
Synonyms: 1110067M05Rik, Trap240, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Pak6
Name: p21 (RAC1) activated kinase 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214230
Homologene: 23200
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Dnahc12, HL19, DLP12, LOC380889, Dnahc7l, 4921531P07Rik, Hdhc3, DHC3, HL-19
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Stat4
Name: signal transducer and activator of transcription 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20849
Homologene: 20679
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Gxylt2
Name: glucoside xylosyltransferase 2
Synonyms: LOC232313, Glt8d4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232313
Homologene: 16823
Acod1
Name: aconitate decarboxylase 1
Synonyms: Irg1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16365
Homologene: 35405
Slc2a2
Name: solute carrier family 2 (facilitated glucose transporter), member 2
Synonyms: Glut2, Glut-2, liver-type glucose transporter
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20526
Homologene: 68047
Scamp1
Name: secretory carrier membrane protein 1
Synonyms: 4930505M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107767
Homologene: 37975
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Hhipl1
Name: hedgehog interacting protein-like 1
Synonyms: 1600002O04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214305
VEGA: 12
Homologene: 81985
Pigs
Name: phosphatidylinositol glycan anchor biosynthesis, class S
Synonyms: LOC276846, LOC245087
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276846
Homologene: 41963
Cmah
Name: cytidine monophospho-N-acetylneuraminic acid hydroxylase
Synonyms: CMP-NeuAc hydroxylase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12763
HGNC: HGNC:2098
Homologene: 7269
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, MommeD9, KAP-1, Tif1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Ugt1a6b
Name: UDP glucuronosyltransferase 1 family, polypeptide A6B
Synonyms: A9'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394435
Homologene: 85959
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Fam83f
Name: family with sequence similarity 83, member F
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213956
VEGA: 15
Homologene: 16313
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Beethoven, Bth, 4933416G09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Stc1
Name: stanniocalcin 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20855
VEGA: 14
Homologene: 2374
Plbd1
Name: phospholipase B domain containing 1
Synonyms: 1100001H23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66857
Homologene: 11745
Or9g3
Name: olfactory receptor family 9 subfamily G member 3
Synonyms: MOR213-6, Olfr1012, GA_x6K02T2Q125-47239120-47238185
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258561
Homologene: 64889
Or5b113
Name: olfactory receptor family 5 subfamily B member 113
Synonyms: MOR202-15, Olfr1467, GA_x6K02T2RE5P-3695694-3696620
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258686
Homologene: 133888
Or51ag1
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: GA_x6K02T2PBJ9-6221839-6220892, Olfr610, MOR9-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259085
Homologene: 17495
Eif3j2
Name: eukaryotic translation initiation factor 3, subunit J2
Synonyms: Gm9781
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042807
HGNC: HGNC:3270
Homologene: 37845
Pla2g2f
Name: phospholipase A2, group IIF
Synonyms: mGIIFsPLA2s
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26971
Homologene: 8084
Or5k15
Name: olfactory receptor family 5 subfamily J member 15
Synonyms: MOR184-6, Olfr178, GA_x54KRFPKG5P-55108059-55107100
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258999
Homologene: 79412
Glrp1
Name: glutamine repeat protein 1
Synonyms: GRP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14659
Or6e1
Name: olfactory receptor family 6 subfamily E member 1
Synonyms: IC6, GA_x6K02T2QVSB-39745261-39746202, Olfr49, MOR118-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18348
Homologene: 106373
Ppp1r14bl
Name: protein phosphatase 1, regulatory inhibitor subunit 14B like
Synonyms: 4933415F23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66755
HGNC: HGNC:9057
Homologene: 103867
Snai1
Name: snail family zinc finger 1
Synonyms: Snail, Sna, Snail1, Sna1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20613
Homologene: 4363
RP23-437D10.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 23,102,102 bp
  • G to A, chromosome 1 at 52,105,236 bp
  • C to A, chromosome 1 at 88,107,448 bp
  • GTGCTGCTGCTGCTGCTGCTGCTGCTG to GTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 88,503,275 bp
  • G to C, chromosome 1 at 90,801,531 bp
  • T to A, chromosome 2 at 85,759,623 bp
  • T to C, chromosome 2 at 112,844,711 bp
  • A to G, chromosome 2 at 118,693,303 bp
  • T to C, chromosome 2 at 167,538,968 bp
  • C to A, chromosome 2 at 180,191,304 bp
  • G to A, chromosome 3 at 28,708,607 bp
  • A to G, chromosome 3 at 138,066,511 bp
  • A to T, chromosome 4 at 11,216,477 bp
  • T to A, chromosome 4 at 138,752,351 bp
  • C to T, chromosome 5 at 124,817,984 bp
  • T to C, chromosome 6 at 100,804,615 bp
  • T to C, chromosome 6 at 121,674,807 bp
  • C to T, chromosome 6 at 136,641,156 bp
  • A to G, chromosome 7 at 13,025,348 bp
  • T to C, chromosome 7 at 19,258,855 bp
  • C to T, chromosome 7 at 24,567,563 bp
  • A to T, chromosome 7 at 41,626,585 bp
  • A to T, chromosome 7 at 103,506,102 bp
  • G to A, chromosome 7 at 127,969,797 bp
  • G to A, chromosome 9 at 108,105,373 bp
  • T to A, chromosome 11 at 78,333,723 bp
  • C to T, chromosome 11 at 86,319,879 bp
  • C to G, chromosome 11 at 120,105,062 bp
  • G to A, chromosome 12 at 108,312,178 bp
  • T to G, chromosome 13 at 24,464,284 bp
  • G to A, chromosome 13 at 76,147,767 bp
  • C to T, chromosome 13 at 94,232,107 bp
  • T to C, chromosome 14 at 26,769,985 bp
  • A to G, chromosome 14 at 52,009,565 bp
  • T to A, chromosome 14 at 54,282,698 bp
  • G to T, chromosome 14 at 67,763,184 bp
  • A to T, chromosome 14 at 69,031,599 bp
  • T to A, chromosome 14 at 103,055,295 bp
  • T to A, chromosome 15 at 78,292,752 bp
  • G to A, chromosome 15 at 80,692,054 bp
  • G to T, chromosome 16 at 58,890,018 bp
  • T to C, chromosome 16 at 93,801,584 bp
  • G to T, chromosome 17 at 19,378,606 bp
  • A to G, chromosome 17 at 36,260,490 bp
  • A to T, chromosome 18 at 43,477,582 bp
  • G to T, chromosome 19 at 13,365,065 bp
  • T to C, chromosome 19 at 20,826,660 bp
  • T to C, chromosome 19 at 43,818,150 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5206 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042781-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.