Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5218Btlr/Mmmh
Stock Number:
042791-MU
Citation ID:
RRID:MMRRC_042791-MU
Other Names:
R5218 (G1), C57BL/6J-MtgxR5218Btlr
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Nur77, TIS1, TR3, N10, NP10, GFRP1, NGFI-B, Hbr-1, Gfrp, Hbr1, Hmr
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,793,595 bp
  • C to A, chromosome 1 at 153,227,696 bp
  • A to T, chromosome 1 at 171,408,760 bp
  • T to C, chromosome 2 at 30,280,052 bp
  • T to C, chromosome 2 at 34,728,476 bp
  • G to A, chromosome 2 at 52,736,293 bp
  • T to C, chromosome 2 at 69,732,783 bp
  • T to C, chromosome 2 at 73,444,468 bp
  • A to T, chromosome 2 at 76,811,243 bp
  • T to C, chromosome 2 at 94,083,263 bp
  • C to T, chromosome 2 at 174,761,552 bp
  • A to G, chromosome 3 at 85,604,444 bp
  • T to A, chromosome 3 at 86,805,678 bp
  • A to G, chromosome 3 at 108,187,770 bp
  • C to A, chromosome 4 at 126,750,810 bp
  • T to C, chromosome 4 at 148,242,876 bp
  • G to C, chromosome 4 at 150,611,994 bp
  • C to T, chromosome 4 at 154,979,728 bp
  • A to G, chromosome 5 at 38,453,181 bp
  • A to G, chromosome 5 at 90,581,918 bp
  • G to A, chromosome 5 at 147,681,928 bp
  • A to T, chromosome 5 at 149,422,254 bp
  • C to A, chromosome 6 at 71,199,960 bp
  • T to C, chromosome 6 at 143,960,890 bp
  • T to C, chromosome 7 at 4,597,920 bp
  • AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC to AATTCAGGCCTAGGCTGGGATTCAGGC, chromosome 7 at 27,327,311 bp
  • T to C, chromosome 7 at 66,025,288 bp
  • T to A, chromosome 7 at 86,802,133 bp
  • A to G, chromosome 7 at 141,261,301 bp
  • C to T, chromosome 8 at 104,442,547 bp
  • T to A, chromosome 8 at 122,598,589 bp
  • T to C, chromosome 9 at 112,143,431 bp
  • T to A, chromosome 10 at 121,619,138 bp
  • C to A, chromosome 10 at 127,548,619 bp
  • C to T, chromosome 11 at 5,281,519 bp
  • G to A, chromosome 11 at 35,684,175 bp
  • T to C, chromosome 11 at 54,129,068 bp
  • T to C, chromosome 11 at 69,916,295 bp
  • A to T, chromosome 11 at 95,062,748 bp
  • C to T, chromosome 12 at 112,063,475 bp
  • A to G, chromosome 13 at 18,152,001 bp
  • G to T, chromosome 13 at 100,506,314 bp
  • T to A, chromosome 14 at 23,463,185 bp
  • T to A, chromosome 14 at 32,816,836 bp
  • CG to C, chromosome 14 at 65,759,662 bp
  • A to T, chromosome 15 at 43,867,244 bp
  • T to C, chromosome 15 at 54,887,586 bp
  • T to C, chromosome 15 at 85,932,384 bp
  • T to C, chromosome 15 at 92,339,549 bp
  • T to A, chromosome 15 at 99,720,130 bp
  • T to A, chromosome 15 at 100,154,296 bp
  • T to C, chromosome 15 at 101,272,153 bp
  • A to T, chromosome 16 at 20,618,540 bp
  • A to T, chromosome 16 at 59,344,907 bp
  • T to C, chromosome 17 at 33,748,950 bp
  • T to A, chromosome 18 at 6,629,628 bp
  • T to A, chromosome 18 at 37,334,335 bp
  • T to G, chromosome 18 at 63,679,467 bp
  • C to T, chromosome 18 at 66,083,158 bp
  • G to T, chromosome X at 139,179,533 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5218 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042791-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.