Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5218Btlr/Mmmh
Stock Number:
042791-MU
Citation ID:
RRID:MMRRC_042791-MU
Other Names:
R5218 (G1), C57BL/6J-MtgxR5218Btlr
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Nur77, TIS1, TR3, N10, NP10, GFRP1, NGFI-B, Hbr-1, Gfrp, Hbr1, Hmr
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: KIK-I, 2610510O05Rik, keratoadhesin, keratonectin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56348
Homologene: 95094
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Txnl1
Name: thioredoxin-like 1
Synonyms: TRP32, 32kDa
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53382
VEGA: 18
Homologene: 3515
Rere
Name: arginine glutamic acid dipeptide (RE) repeats
Synonyms: 1110033A15Rik, atrophin-2, Atr2, eyem03Jus, eyes3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68703
HGNC: HGNC:9965
Homologene: 8101
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66691
Homologene: 32637
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70762
Homologene: 69431
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Xpot
Name: exportin, tRNA (nuclear export receptor for tRNAs)
Synonyms: EXPORTIN-T, C79645, 1110004L07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73192
VEGA: 10
Homologene: 38291
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Ccbe1
Name: collagen and calcium binding EGF domains 1
Synonyms: 9430093N24Rik, 4933426F18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 320924
Homologene: 15852
Dync1li2
Name: dynein, cytoplasmic 1 light intermediate chain 2
Synonyms: LIC2, Dncli2, Dnclic2, Dlic2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234663
HGNC: HGNC:2966
Homologene: 4474
Gps2
Name: G protein pathway suppressor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56310
HGNC: HGNC:4550
Homologene: 49599
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Fabp1
Name: fatty acid binding protein 1, liver
Synonyms: Fabpl, L-FABP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14080
HGNC: HGNC:3555
Homologene: 1106
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226652
Homologene: 18766
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Galns
Name: galactosamine (N-acetyl)-6-sulfatase
Synonyms: N-acetylgalactosamine-6-sulfate sulfatase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50917
HGNC: HGNC:4122
Homologene: 55468
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, VEGFR-1, VEGFR1, Flt-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Ncdn
Name: neurochondrin
Synonyms: neurochondrin-2, neurochondrin-1, norbin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26562
Homologene: 8064
Cntn1
Name: contactin 1
Synonyms: CNTN, F3cam, usl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12805
HGNC: HGNC:2171
Homologene: 7274
Scara5
Name: scavenger receptor class A, member 5
Synonyms: 4932433F15Rik, 4933425F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71145
Homologene: 12556
Pcsk6
Name: proprotein convertase subtilisin/kexin type 6
Synonyms: PACE4, SPC4, b2b2830Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18553
HGNC: HGNC:8569
Homologene: 20569
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Tmem273
Name: transmembrane protein 273
Synonyms: 1810011H11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69069
VEGA: 14
Homologene: 78635
Ece2
Name: endothelin converting enzyme 2
Synonyms: 6330509A19Rik, 9630025D12Rik, 1810009K13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107522
Homologene: 56679
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Albfm1
Name: albumin superfamily member 1
Synonyms: ARG, Gm17754, 5830473C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Slc2a9
Name: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: Glut9, SLC2A9B, SLC2a9A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117591
Homologene: 69290
Disp3
Name: dispatched RND transporter family member 3
Synonyms: G630052C06Rik, Ptchd2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242748
Homologene: 25712
Sox5
Name: SRY (sex determining region Y)-box 5
Synonyms: A730017D01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20678
Homologene: 21378
Phyhd1
Name: phytanoyl-CoA dioxygenase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227696
Homologene: 14939
Wnt10a
Name: wingless-type MMTV integration site family, member 10A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22409
Homologene: 22525
Pou6f2
Name: POU domain, class 6, transcription factor 2
Synonyms: RPF-1, D130006K24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218030
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228005
Homologene: 3520
Gpd1
Name: glycerol-3-phosphate dehydrogenase 1 (soluble)
Synonyms: Gdc-1, Gdc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14555
HGNC: HGNC:4455
Homologene: 5593
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
P4ha2
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
Synonyms: P4hl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18452
HGNC: HGNC:8547
Homologene: 55806
Itga3
Name: integrin alpha 3
Synonyms: VLA-3 alpha 3, alpha3-integrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
4921524L21Rik
Name: RIKEN cDNA 4921524L21 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70901
VEGA: 18
Homologene: 78009
Pcdhb6
Name: protocadherin beta 6
Synonyms: Pcdhb5B, PcdhbF
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93877
HGNC: HGNC:8690
Homologene: 62177
Ocln
Name: occludin
Synonyms: Ocl
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18260
HGNC: HGNC:8104
Homologene: 1905
Medag
Name: mesenteric estrogen dependent adipogenesis
Synonyms: MEDA-4, 6330406I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70717
Homologene: 12364
Tmem74
Name: transmembrane protein 74
Synonyms: B230382K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239408
VEGA: 15
Homologene: 17684
Or5ac24
Name: olfactory receptor family 5 subfamily AC member 24
Synonyms: GA_x54KRFPKG5P-55560552-55559632, MOR182-4, Olfr206
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258993
Homologene: 74262
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: WIP, D2Ertd120e, Waspip
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Rab11b
Name: RAB11B, member RAS oncogene family
Synonyms: A730055L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19326
HGNC: HGNC:9761
Homologene: 68691
Gatb
Name: glutamyl-tRNA amidotransferase subunit B
Synonyms: 9430026F02Rik, Pet112l, Pet112
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229487
HGNC: HGNC:8849
Homologene: 3357
4933428M09Rik
Name: RIKEN cDNA 4933428M09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 71248
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,793,595 bp
  • C to A, chromosome 1 at 153,227,696 bp
  • A to T, chromosome 1 at 171,408,760 bp
  • T to C, chromosome 2 at 30,280,052 bp
  • T to C, chromosome 2 at 34,728,476 bp
  • G to A, chromosome 2 at 52,736,293 bp
  • T to C, chromosome 2 at 69,732,783 bp
  • T to C, chromosome 2 at 73,444,468 bp
  • A to T, chromosome 2 at 76,811,243 bp
  • T to C, chromosome 2 at 94,083,263 bp
  • C to T, chromosome 2 at 174,761,552 bp
  • A to G, chromosome 3 at 85,604,444 bp
  • T to A, chromosome 3 at 86,805,678 bp
  • A to G, chromosome 3 at 108,187,770 bp
  • C to A, chromosome 4 at 126,750,810 bp
  • T to C, chromosome 4 at 148,242,876 bp
  • G to C, chromosome 4 at 150,611,994 bp
  • C to T, chromosome 4 at 154,979,728 bp
  • A to G, chromosome 5 at 38,453,181 bp
  • A to G, chromosome 5 at 90,581,918 bp
  • G to A, chromosome 5 at 147,681,928 bp
  • A to T, chromosome 5 at 149,422,254 bp
  • C to A, chromosome 6 at 71,199,960 bp
  • T to C, chromosome 6 at 143,960,890 bp
  • T to C, chromosome 7 at 4,597,920 bp
  • AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC to AATTCAGGCCTAGGCTGGGATTCAGGC, chromosome 7 at 27,327,311 bp
  • T to C, chromosome 7 at 66,025,288 bp
  • T to A, chromosome 7 at 86,802,133 bp
  • A to G, chromosome 7 at 141,261,301 bp
  • C to T, chromosome 8 at 104,442,547 bp
  • T to A, chromosome 8 at 122,598,589 bp
  • T to C, chromosome 9 at 112,143,431 bp
  • T to A, chromosome 10 at 121,619,138 bp
  • C to A, chromosome 10 at 127,548,619 bp
  • C to T, chromosome 11 at 5,281,519 bp
  • G to A, chromosome 11 at 35,684,175 bp
  • T to C, chromosome 11 at 54,129,068 bp
  • T to C, chromosome 11 at 69,916,295 bp
  • A to T, chromosome 11 at 95,062,748 bp
  • C to T, chromosome 12 at 112,063,475 bp
  • A to G, chromosome 13 at 18,152,001 bp
  • G to T, chromosome 13 at 100,506,314 bp
  • T to A, chromosome 14 at 23,463,185 bp
  • T to A, chromosome 14 at 32,816,836 bp
  • CG to C, chromosome 14 at 65,759,662 bp
  • A to T, chromosome 15 at 43,867,244 bp
  • T to C, chromosome 15 at 54,887,586 bp
  • T to C, chromosome 15 at 85,932,384 bp
  • T to C, chromosome 15 at 92,339,549 bp
  • T to A, chromosome 15 at 99,720,130 bp
  • T to A, chromosome 15 at 100,154,296 bp
  • T to C, chromosome 15 at 101,272,153 bp
  • A to T, chromosome 16 at 20,618,540 bp
  • A to T, chromosome 16 at 59,344,907 bp
  • T to C, chromosome 17 at 33,748,950 bp
  • T to A, chromosome 18 at 6,629,628 bp
  • T to A, chromosome 18 at 37,334,335 bp
  • T to G, chromosome 18 at 63,679,467 bp
  • C to T, chromosome 18 at 66,083,158 bp
  • G to T, chromosome X at 139,179,533 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5218 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042791-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.