Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5219Btlr/Mmmh
Stock Number:
042792-MU
Citation ID:
RRID:MMRRC_042792-MU
Other Names:
R5219 (G1), C57BL/6J-MtgxR5219Btlr
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Akap10
Name: A kinase anchor protein 10
Synonyms: D-AKAP2, 1500031L16Rik, B130049N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56697
HGNC: HGNC:368
Homologene: 32452
Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 3110009L02Rik, 2310045K21Rik, Lars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Sephs1
Name: selenophosphate synthetase 1
Synonyms: SPS1, 1110046B24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109079
Homologene: 56558
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2600016M12Rik, 2810470K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Ssbp3
Name: single-stranded DNA binding protein 3
Synonyms: 2610200M23Rik, 5730488C10Rik, 2610021L12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72475
Homologene: 23411
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Rgp1
Name: RAB6A GEF compex partner 1
Synonyms: 1110029E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242406
Homologene: 8863
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Aip
Name: aryl-hydrocarbon receptor-interacting protein
Synonyms: Ara9, Xap2, D19Bwg1412e, Fkbp16
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11632
HGNC: HGNC:358
Homologene: 2959
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Tcf20
Name: transcription factor 20
Synonyms: SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21411
VEGA: 15
Homologene: 4131
Galr1
Name: galanin receptor 1
Synonyms: Galnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14427
VEGA: 18
HGNC: HGNC:4132
Homologene: 74396
Ppp3cb
Name: protein phosphatase 3, catalytic subunit, beta isoform
Synonyms: PP2BA beta, Calnb, CnAbeta, 1110063J16Rik, Cnab
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19056
HGNC: HGNC:9315
Homologene: 56429
Nadk
Name: NAD kinase
Synonyms: 4432404C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192185
Homologene: 49724
Dhtkd1
Name: dehydrogenase E1 and transketolase domain containing 1
Synonyms: C330018I04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209692
Homologene: 10278
Scnn1g
Name: sodium channel, nonvoltage-gated 1 gamma
Synonyms: ENaC gamma
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20278
Homologene: 20280
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18231
Homologene: 8284
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Agl
Name: amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms: 9430004C13Rik, 9630046L06Rik, 1110061O17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77559
HGNC: HGNC:321
Homologene: 536
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Vmn1r204
Name: vomeronasal 1 receptor 204
Synonyms: Gm11301
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 632793
Homologene: 110880
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Or8g34
Name: olfactory receptor family 8 subfamily G member 34
Synonyms: GA_x6K02T2PVTD-33158015-33158950, MOR171-42, MOR171-53, Olfr954
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258328
VEGA: 9
HGNC: HGNC:8484
Homologene: 71961
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 252866
Homologene: 78104
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Sult1e1
Name: sulfotransferase family 1E, member 1
Synonyms: Ste, EST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20860
Homologene: 101388
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Gp6
Name: glycoprotein 6 platelet
Synonyms: Gpvi, 9830166G18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243816
Homologene: 9488
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Prickle2
Name: prickle planar cell polarity protein 2
Synonyms: 6720451F06Rik, 6230400G14Rik, mpk2, Pk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243548
Homologene: 17889
Klk1b11
Name: kallikrein 1-related peptidase b11
Synonyms: mGK-11, Klk11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16613
Homologene: 68141
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Ces2h
Name: carboxylesterase 2H
Synonyms: Gm5744
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 436059
HGNC: HGNC:1864
Homologene: 128645
Or9k7
Name: olfactory receptor family 9 subfamily K member 7
Synonyms: GA_x6K02T2PULF-11878777-11877809, MOR210-5, Olfr827
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258297
Homologene: 27117
A530064D06Rik
Name: RIKEN cDNA A530064D06 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328830
VEGA: 17
Homologene: 136361
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Vmn1r86
Name: vomeronasal 1 receptor 86
Synonyms: Gm10301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312473
Homologene: 74345
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Or4a73
Name: olfactory receptor family 4 subfamily A member 73
Synonyms: GA_x6K02T2Q125-51034790-51033846, MOR231-9, Olfr1246
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258788
Homologene: 74246
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: 0610012J02Rik, D9Ucla2, Snat3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76257
Homologene: 4983
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Trabd2b
Name: TraB domain containing 2B
Synonyms: Gm12824, Hkat
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666048
Homologene: 85034
Irx2
Name: Iroquois homeobox 2
Synonyms: IRX6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16372
Homologene: 56490
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Rassf7
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms: 2400009B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66985
HGNC: HGNC:1166
Homologene: 2595
Yaf2
Name: YY1 associated factor 2
Synonyms: 2810021M11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67057
Homologene: 4203
Dcxr
Name: dicarbonyl L-xylulose reductase
Synonyms: 1810027P18Rik, 0610038K04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67880
Homologene: 22964
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Or7s1a-ps1
Name: olfactory receptor family 7 subfamily S member 1A, pseudogene 1
Synonyms: GA_x6K02T2PVTD-12676123-12675082, Olfr831-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404431
4933428M09Rik
Name: RIKEN cDNA 4933428M09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 71248
Gm10516
Name: predicted gene 10516
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100038712
1700063H04Rik
Name: RIKEN cDNA 1700063H04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74269
Gm15755
Name: predicted gene 15755
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 102636986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 153,227,696 bp
  • T to A, chromosome 1 at 192,137,513 bp
  • A to G, chromosome 2 at 4,891,690 bp
  • C to T, chromosome 2 at 5,914,816 bp
  • G to A, chromosome 2 at 52,736,293 bp
  • A to T, chromosome 2 at 76,811,243 bp
  • C to T, chromosome 2 at 89,590,702 bp
  • T to G, chromosome 3 at 32,902,041 bp
  • A to G, chromosome 3 at 116,778,721 bp
  • G to C, chromosome 3 at 135,603,736 bp
  • A to T, chromosome 4 at 19,526,366 bp
  • C to T, chromosome 4 at 32,723,690 bp
  • C to T, chromosome 4 at 43,579,440 bp
  • A to T, chromosome 4 at 107,047,458 bp
  • T to C, chromosome 4 at 108,590,769 bp
  • A to G, chromosome 4 at 114,602,810 bp
  • G to T, chromosome 4 at 126,322,264 bp
  • C to A, chromosome 4 at 139,477,232 bp
  • A to G, chromosome 4 at 155,584,254 bp
  • A to T, chromosome 5 at 6,770,703 bp
  • G to T, chromosome 5 at 9,461,486 bp
  • A to T, chromosome 5 at 87,578,586 bp
  • C to A, chromosome 5 at 124,713,185 bp
  • A to G, chromosome 5 at 136,988,121 bp
  • T to A, chromosome 6 at 9,247,765 bp
  • T to C, chromosome 6 at 92,376,530 bp
  • A to T, chromosome 6 at 114,310,221 bp
  • A to G, chromosome 6 at 121,676,950 bp
  • A to G, chromosome 6 at 122,392,340 bp
  • A to G, chromosome 7 at 4,368,999 bp
  • A to G, chromosome 7 at 13,102,455 bp
  • AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC to AATTCAGGCCTAGGCTGGGATTCAGGC, chromosome 7 at 27,327,311 bp
  • A to T, chromosome 7 at 27,327,321 bp
  • G to A, chromosome 7 at 28,104,085 bp
  • G to A, chromosome 7 at 43,999,696 bp
  • A to C, chromosome 7 at 101,504,604 bp
  • T to A, chromosome 7 at 121,766,266 bp
  • T to C, chromosome 7 at 141,211,474 bp
  • C to T, chromosome 8 at 43,651,424 bp
  • T to C, chromosome 8 at 81,884,156 bp
  • T to C, chromosome 8 at 105,016,646 bp
  • T to C, chromosome 9 at 18,932,694 bp
  • G to T, chromosome 9 at 39,462,267 bp
  • A to C, chromosome 9 at 95,881,238 bp
  • A to T, chromosome 9 at 100,985,209 bp
  • A to G, chromosome 9 at 107,651,912 bp
  • T to A, chromosome 10 at 68,278,110 bp
  • T to C, chromosome 10 at 80,709,817 bp
  • A to G, chromosome 10 at 116,506,310 bp
  • T to A, chromosome 10 at 130,210,924 bp
  • A to G, chromosome 11 at 59,375,483 bp
  • A to C, chromosome 11 at 61,922,791 bp
  • A to G, chromosome 11 at 111,725,399 bp
  • G to A, chromosome 11 at 119,843,713 bp
  • T to C, chromosome 11 at 120,725,488 bp
  • A to T, chromosome 13 at 22,556,899 bp
  • G to C, chromosome 13 at 72,631,301 bp
  • G to T, chromosome 14 at 20,528,195 bp
  • C to A, chromosome 15 at 82,856,381 bp
  • A to C, chromosome 15 at 93,285,474 bp
  • G to T, chromosome 17 at 48,163,350 bp
  • C to T, chromosome 17 at 51,742,083 bp
  • A to T, chromosome 18 at 42,234,720 bp
  • A to G, chromosome 18 at 80,447,460 bp
  • A to T, chromosome 18 at 82,393,985 bp
  • T to C, chromosome 19 at 4,115,180 bp
  • G to T, chromosome X at 139,179,533 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5219 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042792-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.