Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5525Btlr/Mmmh
Stock Number:
043083-MU
Citation ID:
RRID:MMRRC_043083-MU
Other Names:
R5525 (G1), C57BL/6J-MtgxR5525Btlr
Major Collection:

Strain Information

Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Cenpm
Name: centromere protein M
Synonyms: 2610019I03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66570
VEGA: 15
Homologene: 11438
Bzw1
Name: basic leucine zipper and W2 domains 1
Synonyms: 1200015E15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66882
Homologene: 41651
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,402,906 bp
  • A to G, chromosome 1 at 66,606,614 bp
  • A to G, chromosome 1 at 89,743,773 bp
  • A to T, chromosome 1 at 107,607,293 bp
  • T to C, chromosome 1 at 136,117,568 bp
  • A to G, chromosome 1 at 188,753,606 bp
  • ACTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGC, chromosome 2 at 26,369,526 bp
  • A to T, chromosome 2 at 87,002,339 bp
  • C to T, chromosome 2 at 181,230,314 bp
  • C to T, chromosome 3 at 87,848,344 bp
  • T to G, chromosome 4 at 32,767,961 bp
  • C to T, chromosome 4 at 43,003,742 bp
  • G to A, chromosome 4 at 46,684,293 bp
  • C to A, chromosome 4 at 55,050,281 bp
  • C to T, chromosome 5 at 9,504,872 bp
  • A to G, chromosome 5 at 115,619,749 bp
  • T to C, chromosome 5 at 142,185,265 bp
  • T to C, chromosome 6 at 12,332,007 bp
  • T to A, chromosome 6 at 92,066,247 bp
  • A to T, chromosome 6 at 93,792,373 bp
  • A to G, chromosome 6 at 113,412,978 bp
  • A to G, chromosome 6 at 118,527,731 bp
  • T to A, chromosome 7 at 26,384,501 bp
  • A to G, chromosome 7 at 79,099,983 bp
  • G to A, chromosome 7 at 83,952,937 bp
  • T to C, chromosome 7 at 89,304,689 bp
  • A to G, chromosome 7 at 108,367,999 bp
  • A to G, chromosome 7 at 139,924,111 bp
  • A to G, chromosome 7 at 144,070,109 bp
  • T to A, chromosome 11 at 70,923,146 bp
  • T to C, chromosome 11 at 86,110,447 bp
  • A to G, chromosome 13 at 23,357,515 bp
  • G to A, chromosome 14 at 54,664,391 bp
  • A to C, chromosome 15 at 82,239,291 bp
  • T to C, chromosome 17 at 25,991,295 bp
  • C to A, chromosome 17 at 29,636,016 bp
  • C to T, chromosome 17 at 37,336,626 bp
  • T to G, chromosome 17 at 80,227,749 bp
  • A to C, chromosome 18 at 65,745,356 bp
  • T to C, chromosome 19 at 29,334,520 bp
  • T to A, chromosome 19 at 41,924,018 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5525 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043083-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.