Strain Name:
Stock Number:
Citation ID:
Other Names:
R5525 (G1), C57BL/6J-MtgxR5525Btlr
Major Collection:

Gene Information

Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14924
Homologene: 31257
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 347722
Homologene: 56689
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54189
Homologene: 3451
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231659
Homologene: 5887
Name: centromere protein M
Synonyms: 2610019I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66570
VEGA: 15
Homologene: 11438
Name: basic leucine zipper and W2 domains 1
Synonyms: 1200015E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66882
Homologene: 41651
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242466
Homologene: 41430
Name: RAB11 family interacting protein 3 (class II)
Synonyms: Rab11-FIP3, D030060O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 215445
Homologene: 49396
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610510L13Rik, 2610036I19Rik, Acinus
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 56215
Homologene: 22853
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72759
Homologene: 11295
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 12H19.01.T7, 6330404C01Rik, 9930013L23Rik, Hybid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 80982
Homologene: 10268
Name: exosome component 1
Synonyms: 2610104C07Rik, 2610035C18Rik, 2610312F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66583
VEGA: 19
Homologene: 9359
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232339
Homologene: 45968
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: BACH1, 8030460J03Rik, 3110009N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237911
Homologene: 32766
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC269160, LOC381317, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Name: olfactory receptor 1102
Synonyms: GA_x6K02T2Q125-48487992-48488966, MOR179-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228228
Homologene: 88426
Name: small nuclear RNA activating complex, polypeptide 4
Synonyms: 5730436L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227644
Homologene: 2321
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229003
Homologene: 14118
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330490
Homologene: 116072
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232237
Homologene: 27798
Name: glutamate receptor, metabotropic 3
Synonyms: mGluR3, 0710001G23Rik, Gprc1c, mGlu3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108069
Homologene: 651
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210274
Homologene: 105965
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330267
Homologene: 46582
Name: olfactory receptor 494
Synonyms: GA_x6K02T2PBJ9-10697517-10698461, MOR204-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258732
Homologene: 133602
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330222
Homologene: 27395
Name: SH2 domain containing 2A
Synonyms: TSAd, Lck-associated adapter protein, Lad, RIBP, Rlk/Itk-binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 27371
Homologene: 2958
Name: relaxin 1
Synonyms: rlx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19773
Homologene: 55524
Name: gamma-aminobutyric acid (GABA) B receptor, 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242425
Homologene: 55902
Name: gem nuclear organelle associated protein 6
Synonyms: 2610019B15Rik, 2810470M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 67242
Homologene: 11711
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11595
Homologene: 137204
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20725
Homologene: 74445
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76484
Homologene: 45138
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101100
Homologene: 134361
Name: O-acyltransferase like
Synonyms: 5330437I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 319888
Homologene: 129774
Name: ring finger protein 8
Synonyms: AIP37, 3830404E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58230
Homologene: 2944
Name: Fanconi anemia, complementation group G
Synonyms: Xrcc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 60534
Homologene: 3402
Name: olfactory receptor 103
Synonyms: MOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258830
Homologene: 115555
Name: zinc finger protein 322A
Synonyms: 9630054P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218100
Homologene: 23460
Name: predicted gene, 37759
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,402,906 bp
  • A to G, chromosome 1 at 66,606,614 bp
  • A to G, chromosome 1 at 89,743,773 bp
  • A to T, chromosome 1 at 107,607,293 bp
  • T to C, chromosome 1 at 136,117,568 bp
  • A to G, chromosome 1 at 188,753,606 bp
  • ACTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGC, chromosome 2 at 26,369,526 bp
  • A to T, chromosome 2 at 87,002,339 bp
  • C to T, chromosome 2 at 181,230,314 bp
  • C to T, chromosome 3 at 87,848,344 bp
  • T to G, chromosome 4 at 32,767,961 bp
  • C to T, chromosome 4 at 43,003,742 bp
  • G to A, chromosome 4 at 46,684,293 bp
  • C to A, chromosome 4 at 55,050,281 bp
  • C to T, chromosome 5 at 9,504,872 bp
  • A to G, chromosome 5 at 115,619,749 bp
  • T to C, chromosome 5 at 142,185,265 bp
  • T to C, chromosome 6 at 12,332,007 bp
  • T to A, chromosome 6 at 92,066,247 bp
  • A to T, chromosome 6 at 93,792,373 bp
  • A to G, chromosome 6 at 113,412,978 bp
  • A to G, chromosome 6 at 118,527,731 bp
  • T to A, chromosome 7 at 26,384,501 bp
  • A to G, chromosome 7 at 79,099,983 bp
  • G to A, chromosome 7 at 83,952,937 bp
  • T to C, chromosome 7 at 89,304,689 bp
  • A to G, chromosome 7 at 108,367,999 bp
  • A to G, chromosome 7 at 139,924,111 bp
  • A to G, chromosome 7 at 144,070,109 bp
  • T to A, chromosome 11 at 70,923,146 bp
  • T to C, chromosome 11 at 86,110,447 bp
  • A to G, chromosome 13 at 23,357,515 bp
  • G to A, chromosome 14 at 54,664,391 bp
  • A to C, chromosome 15 at 82,239,291 bp
  • T to C, chromosome 17 at 25,991,295 bp
  • C to A, chromosome 17 at 29,636,016 bp
  • C to T, chromosome 17 at 37,336,626 bp
  • T to G, chromosome 17 at 80,227,749 bp
  • A to C, chromosome 18 at 65,745,356 bp
  • T to C, chromosome 19 at 29,334,520 bp
  • T to A, chromosome 19 at 41,924,018 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5525 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
043083-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.