Strain Name:
C57BL/6J-MtgxR5525Btlr/Mmmh
Stock Number:
043083-MU
Citation ID:
RRID:MMRRC_043083-MU
Other Names:
R5525 (G1), C57BL/6J-MtgxR5525Btlr
Major Collection:

Strain Information

Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Baiap1, AIP3, BAP1, Gukmi1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: rabaptin-5, neurocrescin, RAB5 effector protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: Gcn1l1, G431004K08Rik, GCN1L
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Cenpm
Name: centromere protein M
Synonyms: 2610019I03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66570
VEGA: 15
Homologene: 11438
Bzw1
Name: basic leucine zipper and W2 domains 1
Synonyms: 1200015E15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66882
Homologene: 41651
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, Zfpip, 9430078C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Rab11fip3
Name: RAB11 family interacting protein 3 (class II)
Synonyms: Rab11-FIP3, D030060O14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 215445
Homologene: 49396
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, LOC213784, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: Acinus, 2610510L13Rik, 2610036I19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56215
Homologene: 22853
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 9930013L23Rik, 12H19.01.T7, Hybid, 6330404C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Exosc1
Name: exosome component 1
Synonyms: 2610035C18Rik, 2610104C07Rik, 2610312F07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66583
VEGA: 19
Homologene: 9359
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: BACH1, 3110009N10Rik, 8030460J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Ush2a
Name: usherin
Synonyms: LOC381317, MUSH2A, A930011D15Rik, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Or5t17
Name: olfactory receptor family 5 subfamily T member 17
Synonyms: MOR179-4, Olfr1102, GA_x6K02T2Q125-48487992-48488966
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228228
Homologene: 88426
Snapc4
Name: small nuclear RNA activating complex, polypeptide 4
Synonyms: 5730436L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227644
Homologene: 2321
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330490
Homologene: 116072
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: C330025N11Rik, ZFYVE23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: Gprc1c, 0710001G23Rik, mGlu3, mGluR3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Or5p69
Name: olfactory receptor family 5 subfamily P member 69
Synonyms: Olfr494, MOR204-10, GA_x6K02T2PBJ9-10697517-10698461
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258732
Homologene: 133602
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Sh2d2a
Name: SH2 domain containing 2A
Synonyms: Rlk/Itk-binding protein, RIBP, TSAd, Lck-associated adapter protein, Lad
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27371
Homologene: 2958
Rln1
Name: relaxin 1
Synonyms: rlx
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19773
Homologene: 55524
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: LOC242425, Gababr2, Gpr51, GB2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Gemin6
Name: gem nuclear organelle associated protein 6
Synonyms: 2810470M17Rik, 2610019B15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67242
Homologene: 11711
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: CAP2, NK10, CAP-2, Spi8, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: B830014K08Rik, VKIND, 2410012C07Rik, very-kind
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Oacyl
Name: O-acyltransferase like
Synonyms: 5330437I02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319888
Homologene: 129774
Rnf8
Name: ring finger protein 8
Synonyms: AIP37, 3830404E21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58230
Homologene: 2944
Fancg
Name: Fanconi anemia, complementation group G
Synonyms: Xrcc9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60534
HGNC: HGNC:3588
Homologene: 3402
Or12d13
Name: olfactory receptor family 12 subfamily D member 13
Synonyms: GA_x6K02T2PSCP-1798423-1797482, MOR250-3, Olfr103, MOR250-8_p
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258830
Homologene: 115555
Zfp322a
Name: zinc finger protein 322A
Synonyms: 9630054P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218100
Homologene: 23460
Gm37759
Name: predicted gene, 37759
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,402,906 bp
  • A to G, chromosome 1 at 66,606,614 bp
  • A to G, chromosome 1 at 89,743,773 bp
  • A to T, chromosome 1 at 107,607,293 bp
  • T to C, chromosome 1 at 136,117,568 bp
  • A to G, chromosome 1 at 188,753,606 bp
  • ACTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGC, chromosome 2 at 26,369,526 bp
  • A to T, chromosome 2 at 87,002,339 bp
  • C to T, chromosome 2 at 181,230,314 bp
  • C to T, chromosome 3 at 87,848,344 bp
  • T to G, chromosome 4 at 32,767,961 bp
  • C to T, chromosome 4 at 43,003,742 bp
  • G to A, chromosome 4 at 46,684,293 bp
  • C to A, chromosome 4 at 55,050,281 bp
  • C to T, chromosome 5 at 9,504,872 bp
  • A to G, chromosome 5 at 115,619,749 bp
  • T to C, chromosome 5 at 142,185,265 bp
  • T to C, chromosome 6 at 12,332,007 bp
  • T to A, chromosome 6 at 92,066,247 bp
  • A to T, chromosome 6 at 93,792,373 bp
  • A to G, chromosome 6 at 113,412,978 bp
  • A to G, chromosome 6 at 118,527,731 bp
  • T to A, chromosome 7 at 26,384,501 bp
  • A to G, chromosome 7 at 79,099,983 bp
  • G to A, chromosome 7 at 83,952,937 bp
  • T to C, chromosome 7 at 89,304,689 bp
  • A to G, chromosome 7 at 108,367,999 bp
  • A to G, chromosome 7 at 139,924,111 bp
  • A to G, chromosome 7 at 144,070,109 bp
  • T to A, chromosome 11 at 70,923,146 bp
  • T to C, chromosome 11 at 86,110,447 bp
  • A to G, chromosome 13 at 23,357,515 bp
  • G to A, chromosome 14 at 54,664,391 bp
  • A to C, chromosome 15 at 82,239,291 bp
  • T to C, chromosome 17 at 25,991,295 bp
  • C to A, chromosome 17 at 29,636,016 bp
  • C to T, chromosome 17 at 37,336,626 bp
  • T to G, chromosome 17 at 80,227,749 bp
  • A to C, chromosome 18 at 65,745,356 bp
  • T to C, chromosome 19 at 29,334,520 bp
  • T to A, chromosome 19 at 41,924,018 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5525 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043083-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.