Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5547Btlr/Mmmh
Stock Number:
043105-MU
Citation ID:
RRID:MMRRC_043105-MU
Other Names:
R5547 (G1), C57BL/6J-MtgxR5547Btlr
Major Collection:

Strain Information

Lhx5
Name: LIM homeobox protein 5
Synonyms: Lim2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16873
Homologene: 40621
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233900
Homologene: 8856
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,160,976 bp
  • A to G, chromosome 1 at 150,737,506 bp
  • A to C, chromosome 1 at 156,705,646 bp
  • C to A, chromosome 1 at 165,306,413 bp
  • C to T, chromosome 2 at 125,740,737 bp
  • T to A, chromosome 3 at 65,669,180 bp
  • T to C, chromosome 3 at 81,958,940 bp
  • T to C, chromosome 3 at 100,056,152 bp
  • T to C, chromosome 3 at 136,066,349 bp
  • C to T, chromosome 3 at 151,761,505 bp
  • C to T, chromosome 3 at 154,611,557 bp
  • G to A, chromosome 4 at 6,426,429 bp
  • C to T, chromosome 4 at 56,910,156 bp
  • A to T, chromosome 4 at 144,158,028 bp
  • A to G, chromosome 5 at 49,999,292 bp
  • A to G, chromosome 5 at 64,324,544 bp
  • G to A, chromosome 5 at 76,230,338 bp
  • A to G, chromosome 5 at 120,434,610 bp
  • T to A, chromosome 5 at 147,655,138 bp
  • A to G, chromosome 6 at 37,965,550 bp
  • A to T, chromosome 6 at 41,636,154 bp
  • G to T, chromosome 7 at 4,554,222 bp
  • A to C, chromosome 7 at 25,303,963 bp
  • A to G, chromosome 7 at 27,989,419 bp
  • G to T, chromosome 7 at 102,013,930 bp
  • T to C, chromosome 7 at 127,589,130 bp
  • T to C, chromosome 8 at 70,652,419 bp
  • T to C, chromosome 9 at 8,100,427 bp
  • T to C, chromosome 9 at 36,712,104 bp
  • T to C, chromosome 10 at 23,109,854 bp
  • G to T, chromosome 10 at 80,259,272 bp
  • C to T, chromosome 10 at 107,782,048 bp
  • A to G, chromosome 11 at 43,490,967 bp
  • C to T, chromosome 11 at 61,451,028 bp
  • C to T, chromosome 13 at 58,102,429 bp
  • T to A, chromosome 13 at 60,800,737 bp
  • A to G, chromosome 14 at 65,641,881 bp
  • T to C, chromosome 14 at 79,213,966 bp
  • T to A, chromosome 15 at 4,808,488 bp
  • G to A, chromosome 15 at 76,705,794 bp
  • A to G, chromosome 16 at 4,770,124 bp
  • G to A, chromosome 16 at 59,269,116 bp
  • T to A, chromosome 16 at 93,609,810 bp
  • T to C, chromosome 17 at 22,454,892 bp
  • TGATGATGACGATGATGACGATGATGA to TGATGATGACGATGATGA, chromosome 17 at 33,912,641 bp
  • CGATGATGATGA to CGA, chromosome 17 at 33,912,659 bp
  • G to A, chromosome 17 at 36,057,904 bp
  • T to G, chromosome 18 at 20,336,040 bp
  • A to G, chromosome 18 at 56,528,284 bp
  • T to C, chromosome 19 at 6,910,788 bp
  • T to C, chromosome 19 at 17,752,124 bp
  • T to C, chromosome 19 at 42,124,943 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5547 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043105-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.