Strain Name:
C57BL/6J-MtgxR5854Btlr/Mmmh
Stock Number:
043228-MU
Citation ID:
RRID:MMRRC_043228-MU
Other Names:
R5854 (G1), C57BL/6J-MtgxR5854Btlr
Major Collection:

Gene Information

Hnrnpab
Name: heterogeneous nuclear ribonucleoprotein A/B
Synonyms: CBF-A, Hnrpab, Cgbfa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15384
HGNC: HGNC:5034
Homologene: 74950
Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: Sema6D-5, Sema6D-6, Sema6D-1, 1110067B02Rik, Sema6D-4, Sema6D-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 214968
Homologene: 16195
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11287
Homologene: 104112
Tfpi
Name: tissue factor pathway inhibitor
Synonyms: A630013F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 21788
Homologene: 4579
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, 4921505C17Rik, D530039E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 78757
VEGA: 15
Homologene: 34317
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: IKK 1, Chuk1, IkappaB kinase alpha, IKK-1, IKKalpha, IKK alpha, IKK-alpha, IKK1, IKK[a]
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Knl1
Name: kinetochore scaffold 1
Synonyms: 5730505K17Rik, Casc5, 2310043D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76464
Homologene: 44890
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 208727
Homologene: 55946
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 214133
Homologene: 49498
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 73254
Homologene: 35455
Sft2d1
Name: SFT2 domain containing 1
Synonyms: 5630401J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 106489
Homologene: 34525
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 66887
Homologene: 12050
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Atg4c
Name: autophagy related 4C, cysteine peptidase
Synonyms: Apg4-C, Autl1, Apg4c, autophagin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242557
Homologene: 56296
Dsp
Name: desmoplakin
Synonyms: rul, 2300002E22Rik, DP, 5730453H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Hnrnpa2b1
Name: heterogeneous nuclear ribonucleoprotein A2/B1
Synonyms: Hnrpa2, Hnrpa2b1, 9130414A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 53379
HGNC: HGNC:5033
Homologene: 22992
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, Dnahc8, P1-Loop
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20499
VEGA: 13
Homologene: 21312
Nelfb
Name: negative elongation factor complex member B
Synonyms: A730008L03Rik, Cobra1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 58202
Homologene: 121600
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 5830412M15Rik, 9930026A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 67883
Homologene: 41609
Ppp2r5b
Name: protein phosphatase 2, regulatory subunit B', beta
Synonyms: B'beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225849
HGNC: HGNC:9310
Homologene: 38157
Gcgr
Name: glucagon receptor
Synonyms: GR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14527
HGNC: HGNC:4192
Homologene: 131
Olfr914
Name: olfactory receptor 914
Synonyms: MOR165-7, GA_x6K02T2PVTD-32308823-32309773
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258782
VEGA: 9
Homologene: 115511
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, PKHDL1, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Spaca6
Name: sperm acrosome associated 6
Synonyms: B230206P06Rik, Ncrna00085, 4930546H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 75202
Homologene: 53443
Dalrd3
Name: DALR anticodon binding domain containing 3
Synonyms: 6330580J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 67789
Homologene: 32388
Morn3
Name: MORN repeat containing 3
Synonyms: 4930438O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 74890
Homologene: 42069
Abca8b
Name: ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms: Abca8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Gm5155
Name: predicted gene 5155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 381852
Homologene: 115938
Myom2
Name: myomesin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Olfr53
Name: olfactory receptor 53
Synonyms: GA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258962
Homologene: 133678
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 50720
Fbxo41
Name: F-box protein 41
Synonyms: D6Ertd538e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 330369
Homologene: 19837
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22625
Homologene: 19318
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 76645
Homologene: 124481
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
Myo18b
Name: myosin XVIIIb
Synonyms: 4933411E19Rik, 4932408L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 74376
Homologene: 53435
Noxo1
Name: NADPH oxidase organizer 1
Synonyms: 2310034C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71893
Homologene: 12418
Hsp90b1
Name: heat shock protein 90, beta (Grp94), member 1
Synonyms: gp96, 90 kDa, Tra-1, ERp99, Targ2, tumor rejection antigen (gp96) 1, endoplasmin, Tra1, GRP94
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 22027
Homologene: 2476
Olfr312
Name: olfactory receptor 312
Synonyms: MOR222-4P, GA_x6K02T2NKPP-575829-574903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258065
Homologene: 77375
Stk32c
Name: serine/threonine kinase 32C
Synonyms: Pkek, YANK3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57740
Homologene: 75157
Amz2
Name: archaelysin family metallopeptidase 2
Synonyms: ESTM12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 100503496
Rpe65
Name: retinal pigment epithelium 65
Synonyms: rd12, Mord1, A930029L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 19892
Homologene: 20108
Cst13
Name: cystatin 13
Synonyms: 1700006C19Rik, Cymg1, cystatin T
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 69294
Homologene: 41707
Nans
Name: N-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms: Sas, 4632418E04Rik, N-acetylneuraminic acid phosphate synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 94181
Homologene: 10343
Fcrlb
Name: Fc receptor-like B
Synonyms: FcRL2, Fcry, mFCRL2, FREB2, FREB-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 435653
Homologene: 83202
Zfp703
Name: zinc finger protein 703
Synonyms: 1110032O19Rik, Csmn1, End2, Zeppo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 353310
Homologene: 81391
Gm16564
Name: predicted gene 16564
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,780,073 bp
  • C to A, chromosome 1 at 54,419,437 bp
  • A to T, chromosome 1 at 63,147,389 bp
  • T to C, chromosome 1 at 91,959,421 bp
  • G to T, chromosome 1 at 127,830,355 bp
  • T to C, chromosome 1 at 170,907,961 bp
  • C to T, chromosome 1 at 178,916,897 bp
  • T to C, chromosome 2 at 25,209,993 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA, chromosome 2 at 84,434,424 bp
  • A to G, chromosome 2 at 119,070,403 bp
  • A to G, chromosome 2 at 124,659,697 bp
  • A to G, chromosome 2 at 148,828,174 bp
  • T to A, chromosome 3 at 133,487,885 bp
  • A to G, chromosome 3 at 159,615,676 bp
  • A to G, chromosome 4 at 46,500,180 bp
  • T to C, chromosome 4 at 88,868,359 bp
  • G to A, chromosome 4 at 99,228,559 bp
  • A to G, chromosome 5 at 108,206,728 bp
  • A to G, chromosome 5 at 112,803,219 bp
  • A to G, chromosome 5 at 123,041,115 bp
  • C to G, chromosome 6 at 51,466,609 bp
  • A to G, chromosome 6 at 85,475,094 bp
  • A to T, chromosome 6 at 128,506,869 bp
  • A to T, chromosome 7 at 17,873,444 bp
  • A to G, chromosome 7 at 139,188,279 bp
  • A to G, chromosome 7 at 140,652,578 bp
  • A to G, chromosome 8 at 15,108,478 bp
  • C to T, chromosome 8 at 26,979,205 bp
  • T to A, chromosome 8 at 86,673,071 bp
  • T to G, chromosome 8 at 117,065,746 bp
  • T to C, chromosome 9 at 38,606,663 bp
  • T to C, chromosome 9 at 108,570,077 bp
  • A to T, chromosome 10 at 86,695,644 bp
  • T to C, chromosome 11 at 51,604,681 bp
  • T to A, chromosome 11 at 58,831,556 bp
  • T to A, chromosome 11 at 109,434,672 bp
  • C to A, chromosome 11 at 109,977,813 bp
  • G to A, chromosome 11 at 120,536,419 bp
  • A to G, chromosome 13 at 38,167,501 bp
  • A to G, chromosome 13 at 73,793,940 bp
  • C to T, chromosome 14 at 61,211,547 bp
  • G to A, chromosome 15 at 6,794,006 bp
  • A to G, chromosome 15 at 44,581,790 bp
  • C to T, chromosome 17 at 8,320,653 bp
  • A to T, chromosome 17 at 17,831,247 bp
  • T to C, chromosome 17 at 24,698,542 bp
  • T to A, chromosome 17 at 30,794,763 bp
  • A to G, chromosome 19 at 6,230,944 bp
  • T to C, chromosome 19 at 44,081,957 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5854 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
043228-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.