Strain Name:
C57BL/6J-MtgxR5854Btlr/Mmmh
Stock Number:
043228-MU
Citation ID:
RRID:MMRRC_043228-MU
Other Names:
R5854 (G1), C57BL/6J-MtgxR5854Btlr
Major Collection:

Strain Information

Hnrnpab
Name: heterogeneous nuclear ribonucleoprotein A/B
Synonyms: Cgbfa, Hnrpab, CBF-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15384
HGNC: HGNC:5034
Homologene: 74950
Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: Sema6D-1, Sema6D-4, Sema6D-5, 1110067B02Rik, Sema6D-6, Sema6D-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214968
Homologene: 16195
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Tfpi
Name: tissue factor pathway inhibitor
Synonyms: A630013F22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21788
Homologene: 4579
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, 4921505C17Rik, D530039E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: IKKalpha, IKK alpha, Chuk1, IKK-1, IKK1, IKK[a], IKK-alpha, IkappaB kinase alpha, IKK 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Knl1
Name: kinetochore scaffold 1
Synonyms: 5730505K17Rik, 2310043D08Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208727
Homologene: 55946
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: Ayu17-449, E130014J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Sft2d1
Name: SFT2 domain containing 1
Synonyms: 5630401J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106489
Homologene: 34525
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Atg4c
Name: autophagy related 4C, cysteine peptidase
Synonyms: Apg4-C, Apg4c, autophagin 3, Autl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242557
Homologene: 56296
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, rul, DP, 5730453H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Hnrnpa2b1
Name: heterogeneous nuclear ribonucleoprotein A2/B1
Synonyms: 9130414A06Rik, Hnrpa2b1, Hnrpa2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53379
HGNC: HGNC:5033
Homologene: 22992
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: P1-Loop, Hst6.7b, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Nelfb
Name: negative elongation factor complex member B
Synonyms: Cobra1, A730008L03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58202
Homologene: 121600
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 9930026A05Rik, 5830412M15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67883
Homologene: 41609
Ppp2r5b
Name: protein phosphatase 2, regulatory subunit B', beta
Synonyms: B'beta
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225849
HGNC: HGNC:9310
Homologene: 38157
Gcgr
Name: glucagon receptor
Synonyms: GR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14527
HGNC: HGNC:4192
Homologene: 131
Or8b50
Name: olfactory receptor family 8 subfamily B member 50
Synonyms: Olfr914, GA_x6K02T2PVTD-32308823-32309773, MOR165-7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258782
VEGA: 9
Homologene: 115511
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, PKHDL1, D86 mRNA
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Spaca6
Name: sperm acrosome associated 6
Synonyms: B230206P06Rik, 4930546H06Rik, Ncrna00085
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75202
Homologene: 53443
Dalrd3
Name: DALR anticodon binding domain containing 3
Synonyms: 6330580J24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67789
Homologene: 32388
Morn3
Name: MORN repeat containing 3
Synonyms: 4930438O03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74890
Homologene: 42069
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Ceacam23
Name: CEA cell adhesion moleculen23
Synonyms: Gm5155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381852
HGNC: HGNC:1819
Homologene: 115938
Or13a20
Name: olfactory receptor family 13 subfamily A member 20
Synonyms: Olfr53, IE12, GA_x6K02T2PBJ9-42798103-42799038, MOR253-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258962
Homologene: 133678
Fbxo41
Name: F-box protein 41
Synonyms: D6Ertd538e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330369
Homologene: 19837
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mouse
Chromosome: 4
Myo18b
Name: myosin XVIIIb
Synonyms: 4933411E19Rik, 4932408L24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Noxo1
Name: NADPH oxidase organizer 1
Synonyms: 2310034C04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71893
Homologene: 12418
Hsp90b1
Name: heat shock protein 90, beta (Grp94), member 1
Synonyms: gp96, endoplasmin, 90 kDa, Tra-1, Targ2, tumor rejection antigen (gp96) 1, GRP94, Tra1, ERp99
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22027
Homologene: 2476
Or5af1
Name: olfactory receptor family 5 subfamily AF member 1
Synonyms: Olfr312, GA_x6K02T2NKPP-575829-574903, MOR222-4P
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258065
Homologene: 77375
Stk32c
Name: serine/threonine kinase 32C
Synonyms: Pkek, YANK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57740
Homologene: 75157
Amz2
Name: archaelysin family metallopeptidase 2
Synonyms: ESTM12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13929
Rpe65
Name: retinal pigment epithelium 65
Synonyms: Mord1, rd12, A930029L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19892
Homologene: 20108
Cst13
Name: cystatin 13
Synonyms: Cymg1, cystatin T, 1700006C19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69294
Homologene: 41707
Nans
Name: N-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms: Sas, N-acetylneuraminic acid phosphate synthase, 4632418E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 94181
Homologene: 10343
Fcrlb
Name: Fc receptor-like B
Synonyms: Fcry, FREB2, FREB-2, mFCRL2, FcRL2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435653
Homologene: 83202
Zfp703
Name: zinc finger protein 703
Synonyms: 1110032O19Rik, Csmn1, End2, Zeppo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353310
Homologene: 81391
Gm16564
Name: predicted gene 16564
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,780,073 bp
  • C to A, chromosome 1 at 54,419,437 bp
  • A to T, chromosome 1 at 63,147,389 bp
  • T to C, chromosome 1 at 91,959,421 bp
  • G to T, chromosome 1 at 127,830,355 bp
  • T to C, chromosome 1 at 170,907,961 bp
  • C to T, chromosome 1 at 178,916,897 bp
  • T to C, chromosome 2 at 25,209,993 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA, chromosome 2 at 84,434,424 bp
  • A to G, chromosome 2 at 119,070,403 bp
  • A to G, chromosome 2 at 124,659,697 bp
  • A to G, chromosome 2 at 148,828,174 bp
  • T to A, chromosome 3 at 133,487,885 bp
  • A to G, chromosome 3 at 159,615,676 bp
  • A to G, chromosome 4 at 46,500,180 bp
  • T to C, chromosome 4 at 88,868,359 bp
  • G to A, chromosome 4 at 99,228,559 bp
  • A to G, chromosome 5 at 108,206,728 bp
  • A to G, chromosome 5 at 112,803,219 bp
  • A to G, chromosome 5 at 123,041,115 bp
  • C to G, chromosome 6 at 51,466,609 bp
  • A to G, chromosome 6 at 85,475,094 bp
  • A to T, chromosome 6 at 128,506,869 bp
  • A to T, chromosome 7 at 17,873,444 bp
  • A to G, chromosome 7 at 139,188,279 bp
  • A to G, chromosome 7 at 140,652,578 bp
  • A to G, chromosome 8 at 15,108,478 bp
  • C to T, chromosome 8 at 26,979,205 bp
  • T to A, chromosome 8 at 86,673,071 bp
  • T to G, chromosome 8 at 117,065,746 bp
  • T to C, chromosome 9 at 38,606,663 bp
  • T to C, chromosome 9 at 108,570,077 bp
  • A to T, chromosome 10 at 86,695,644 bp
  • T to C, chromosome 11 at 51,604,681 bp
  • T to A, chromosome 11 at 58,831,556 bp
  • T to A, chromosome 11 at 109,434,672 bp
  • C to A, chromosome 11 at 109,977,813 bp
  • G to A, chromosome 11 at 120,536,419 bp
  • A to G, chromosome 13 at 38,167,501 bp
  • A to G, chromosome 13 at 73,793,940 bp
  • C to T, chromosome 14 at 61,211,547 bp
  • G to A, chromosome 15 at 6,794,006 bp
  • A to G, chromosome 15 at 44,581,790 bp
  • C to T, chromosome 17 at 8,320,653 bp
  • A to T, chromosome 17 at 17,831,247 bp
  • T to C, chromosome 17 at 24,698,542 bp
  • T to A, chromosome 17 at 30,794,763 bp
  • A to G, chromosome 19 at 6,230,944 bp
  • T to C, chromosome 19 at 44,081,957 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5854 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043228-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.