Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5773Btlr/Mmmh
Stock Number:
043372-MU
Citation ID:
RRID:MMRRC_043372-MU
Other Names:
R5773 (G1)
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Cradd
Name: CASP2 and RIPK1 domain containing adaptor with death domain
Synonyms: RAIDD
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12905
VEGA: 10
HGNC: HGNC:2340
Homologene: 2821
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Ap2m1
Name: adaptor-related protein complex 2, mu 1 subunit
Synonyms: clathrin-associated AP-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11773
HGNC: HGNC:564
Homologene: 3000
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 57,879,549 bp
  • T to C, chromosome 1 at 87,386,667 bp
  • A to G, chromosome 1 at 131,158,303 bp
  • T to C, chromosome 2 at 30,322,196 bp
  • A to G, chromosome 2 at 121,243,914 bp
  • G to A, chromosome 2 at 155,574,694 bp
  • A to G, chromosome 2 at 155,799,909 bp
  • A to G, chromosome 2 at 179,885,996 bp
  • A to T, chromosome 4 at 12,145,765 bp
  • C to A, chromosome 4 at 58,099,985 bp
  • C to T, chromosome 4 at 63,395,070 bp
  • A to G, chromosome 4 at 118,869,521 bp
  • A to T, chromosome 4 at 126,905,370 bp
  • T to G, chromosome 4 at 141,929,570 bp
  • A to G, chromosome 5 at 64,954,503 bp
  • A to C, chromosome 5 at 92,250,561 bp
  • C to A, chromosome 5 at 110,106,891 bp
  • G to A, chromosome 5 at 123,794,157 bp
  • A to T, chromosome 5 at 143,713,712 bp
  • T to A, chromosome 6 at 21,971,835 bp
  • C to A, chromosome 6 at 70,138,600 bp
  • T to C, chromosome 6 at 91,085,883 bp
  • A to T, chromosome 7 at 5,034,694 bp
  • GGC to GGCGGCGGCTGC, chromosome 7 at 97,579,933 bp
  • A to T, chromosome 7 at 107,685,872 bp
  • A to G, chromosome 8 at 21,656,558 bp
  • A to G, chromosome 8 at 22,027,863 bp
  • G to A, chromosome 8 at 70,652,451 bp
  • A to T, chromosome 8 at 104,305,176 bp
  • T to A, chromosome 9 at 44,299,236 bp
  • T to C, chromosome 9 at 54,334,491 bp
  • A to G, chromosome 10 at 20,246,644 bp
  • T to A, chromosome 10 at 23,961,158 bp
  • T to G, chromosome 10 at 78,793,277 bp
  • T to C, chromosome 10 at 95,175,961 bp
  • T to C, chromosome 10 at 121,896,709 bp
  • T to A, chromosome 10 at 127,444,303 bp
  • G to T, chromosome 11 at 70,555,932 bp
  • A to T, chromosome 11 at 94,939,429 bp
  • T to C, chromosome 12 at 4,707,089 bp
  • A to T, chromosome 12 at 79,287,737 bp
  • GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC to G, chromosome 12 at 85,933,555 bp
  • T to A, chromosome 13 at 49,901,876 bp
  • A to T, chromosome 14 at 20,698,315 bp
  • A to G, chromosome 14 at 30,935,399 bp
  • C to T, chromosome 14 at 51,364,348 bp
  • A to G, chromosome 14 at 67,796,058 bp
  • T to C, chromosome 14 at 78,595,455 bp
  • T to C, chromosome 15 at 88,689,549 bp
  • G to T, chromosome 15 at 93,508,597 bp
  • T to C, chromosome 16 at 20,543,390 bp
  • C to A, chromosome 16 at 37,208,097 bp
  • T to A, chromosome 16 at 75,573,925 bp
  • C to A, chromosome 17 at 34,857,272 bp
  • A to T, chromosome 18 at 36,969,590 bp
  • G to T, chromosome 18 at 58,582,173 bp
  • T to A, chromosome 18 at 77,960,825 bp
  • T to C, chromosome 19 at 56,813,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.