Strain Name:
Stock Number:
Citation ID:
Other Names:
R5773 (G1)
Major Collection:

Strain Information

Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
Homologene: 73874
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, ste, mste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
Homologene: 20851
Name: CASP2 and RIPK1 domain containing adaptor with death domain
Synonyms: RAIDD
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12905
VEGA: 10
Homologene: 2821
Name: nucleoporin 188
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227699
Homologene: 45683
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Name: adaptor-related protein complex 2, mu 1 subunit
Synonyms: clathrin-associated AP-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11773
Homologene: 3000
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Name: diacylglycerol kinase, eta
Synonyms: 5930402B05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380921
VEGA: 14
Homologene: 99373
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
Homologene: 7486
Name: bromodomain containing 1
Synonyms: 1110059H06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223770
Homologene: 40956
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Name: eukaryotic translation initiation factor 2D
Synonyms: D1Ertd5e, Lgtn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16865
Homologene: 38244
Name: inhibitor of growth family, member 3
Synonyms: P47ING3, 1300013A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71777
Homologene: 6804
Name: ectopic P-granules 5 autophagy tethering factor
Synonyms: 5430411K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
Homologene: 22627
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, mpk1, b2b019Clo, Pk1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106042
Homologene: 17686
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 2310009M18Rik, 1700048H13Rik, D630041K24Rik, STAMP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Name: spermatogenesis associated, serine-rich 2-like
Synonyms: A230104H11Rik, 2810022L02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67198
Homologene: 56711
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Name: immunoglobulin kappa chain variable 6-29
Synonyms: Gm16692
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 620191
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11979
Homologene: 20063
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Name: predicted gene 7247
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 638695
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Name: olfactory receptor family 10 subfamily AK member 9
Synonyms: GA_x6K02T2QD9B-18670866-18669913, MOR259-3P, Olfr1331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258159
Homologene: 134082
Name: cadherin 4
Synonyms: Rcad, R-cadherin, R-Cadh
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12561
Homologene: 48044
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
Homologene: 1667
Name: solute carrier family 27 (fatty acid transporter), member 6
Synonyms: FATP6, 4732438L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225579
Homologene: 38385
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Name: trace amine-associated receptor 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209513
Homologene: 45509
Name: protein phosphatase, EF hand calcium-binding domain 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19023
Homologene: 55959
Name: phospholipase D2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18806
Homologene: 55672
Name: histone H4 transcription factor
Synonyms: DKFZp434F162, Mizf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102423
Homologene: 9174
Name: coiled-coil domain containing 186
Synonyms: Otg1, 1810028B20Rik, A630007B06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 213993
Homologene: 9963
Name: pyroglutamyl-peptidase I
Synonyms: PGP-I, Pcp, 2810003H13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66522
Homologene: 9793
Name: complement factor B
Synonyms: B, Factor B, alternative-complement pathway C3/C5 convertase, Bf, FB, H2-Bf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14962
Homologene: 1292
Name: RNA binding motif protein 12 B1
Synonyms: 3000004N20Rik, Rbm12b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72397
Homologene: 28658
Name: GTP binding protein 6 (putative)
Synonyms: pgpl, Pgbpll
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107999
Homologene: 8157
Name: potassium inwardly-rectifying channel, subfamily J, member 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040591
Homologene: 55638
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17391
Homologene: 21331
Name: zinc finger protein 865
Synonyms: 6430526N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319748
Homologene: 19652
Name: fucosyltransferase 11
Synonyms: 3110009G03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73068
VEGA: 14
Homologene: 18313
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Name: lipase, member I
Synonyms: D930038D03Rik, lpd1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320355
Homologene: 77864
Name: gliomedin
Synonyms: Crlg2, CRG-L2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235379
Homologene: 14529
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Name: predicted gene 8674
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 667507
VEGA: 13
Homologene: 140547
Name: protocadherin alpha 6
Synonyms: Cnr2, Crnr2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12937
Homologene: 75098
Name: defensin, alpha, 17
Synonyms: cryptdin 17, Crypt defensin 17, Cryp17, Defcr17
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23855
Homologene: 113382
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 57,879,549 bp
  • T to C, chromosome 1 at 87,386,667 bp
  • A to G, chromosome 1 at 131,158,303 bp
  • T to C, chromosome 2 at 30,322,196 bp
  • A to G, chromosome 2 at 121,243,914 bp
  • G to A, chromosome 2 at 155,574,694 bp
  • A to G, chromosome 2 at 155,799,909 bp
  • A to G, chromosome 2 at 179,885,996 bp
  • A to T, chromosome 4 at 12,145,765 bp
  • C to A, chromosome 4 at 58,099,985 bp
  • C to T, chromosome 4 at 63,395,070 bp
  • A to G, chromosome 4 at 118,869,521 bp
  • A to T, chromosome 4 at 126,905,370 bp
  • T to G, chromosome 4 at 141,929,570 bp
  • A to G, chromosome 5 at 64,954,503 bp
  • A to C, chromosome 5 at 92,250,561 bp
  • C to A, chromosome 5 at 110,106,891 bp
  • G to A, chromosome 5 at 123,794,157 bp
  • A to T, chromosome 5 at 143,713,712 bp
  • T to A, chromosome 6 at 21,971,835 bp
  • C to A, chromosome 6 at 70,138,600 bp
  • T to C, chromosome 6 at 91,085,883 bp
  • A to T, chromosome 7 at 5,034,694 bp
  • GGC to GGCGGCGGCTGC, chromosome 7 at 97,579,933 bp
  • A to T, chromosome 7 at 107,685,872 bp
  • A to G, chromosome 8 at 21,656,558 bp
  • A to G, chromosome 8 at 22,027,863 bp
  • G to A, chromosome 8 at 70,652,451 bp
  • A to T, chromosome 8 at 104,305,176 bp
  • T to A, chromosome 9 at 44,299,236 bp
  • T to C, chromosome 9 at 54,334,491 bp
  • A to G, chromosome 10 at 20,246,644 bp
  • T to A, chromosome 10 at 23,961,158 bp
  • T to G, chromosome 10 at 78,793,277 bp
  • T to C, chromosome 10 at 95,175,961 bp
  • T to C, chromosome 10 at 121,896,709 bp
  • T to A, chromosome 10 at 127,444,303 bp
  • G to T, chromosome 11 at 70,555,932 bp
  • A to T, chromosome 11 at 94,939,429 bp
  • T to C, chromosome 12 at 4,707,089 bp
  • A to T, chromosome 12 at 79,287,737 bp
  • GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC to G, chromosome 12 at 85,933,555 bp
  • T to A, chromosome 13 at 49,901,876 bp
  • A to T, chromosome 14 at 20,698,315 bp
  • A to G, chromosome 14 at 30,935,399 bp
  • C to T, chromosome 14 at 51,364,348 bp
  • A to G, chromosome 14 at 67,796,058 bp
  • T to C, chromosome 14 at 78,595,455 bp
  • T to C, chromosome 15 at 88,689,549 bp
  • G to T, chromosome 15 at 93,508,597 bp
  • T to C, chromosome 16 at 20,543,390 bp
  • C to A, chromosome 16 at 37,208,097 bp
  • T to A, chromosome 16 at 75,573,925 bp
  • C to A, chromosome 17 at 34,857,272 bp
  • A to T, chromosome 18 at 36,969,590 bp
  • G to T, chromosome 18 at 58,582,173 bp
  • T to A, chromosome 18 at 77,960,825 bp
  • T to C, chromosome 19 at 56,813,487 bp
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.