Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5774Btlr
Stock Number:
043373-MU
Citation ID:
RRID:MMRRC_043373-MU
Other Names:
R5774 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Mdk
Name: midkine
Synonyms: MK, Mek
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17242
HGNC: HGNC:6972
Homologene: 1792
Cep55
Name: centrosomal protein 55
Synonyms: 2700032M20Rik, 1200008O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74107
VEGA: 19
HGNC: HGNC:1161
Homologene: 10019
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, 9530057A13Rik, 4932439K10Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Stx16
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228960
Homologene: 2791
Utp6
Name: UTP6 small subunit processome component
Synonyms: HCA66, 4732497O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216987
Homologene: 41265
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Ddx52
Name: DExD box helicase 52
Synonyms: 2700029C06Rik, ROK1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78394
Homologene: 5093
Ing3
Name: inhibitor of growth family, member 3
Synonyms: P47ING3, 1300013A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71777
Homologene: 6804
Xpo5
Name: exportin 5
Synonyms: 2410004H11Rik, 2700038C24Rik, Exp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72322
VEGA: 17
Homologene: 69316
Atp6v1b2
Name: ATPase, H+ transporting, lysosomal V1 subunit B2
Synonyms: HO57, Atp6b2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11966
HGNC: HGNC:854
Homologene: 1279
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268970
Homologene: 18264
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Dennd6a
Name: DENN domain containing 6A
Synonyms: A630054L15Rik, Fam116a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211922
Homologene: 13503
Arhgap1
Name: Rho GTPase activating protein 1
Synonyms: B230365D05Rik, p50rhoGAP, Cdc42GAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228359
HGNC: HGNC:673
Homologene: 20909
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Ttll5
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 1700048H13Rik, 2310009M18Rik, D630041K24Rik, STAMP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Spocd1
Name: SPOC domain containing 1
Synonyms: OTTMUSG00000009522
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622480
Homologene: 83439
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640524
Homologene: 41150
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Or8k33
Name: olfactory receptor family 8 subfamily K member 33
Synonyms: GA_x6K02T2Q125-48039418-48038477, MOR192-1, Olfr1080
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258404
Homologene: 104285
Mmp12
Name: matrix metallopeptidase 12
Synonyms: macrophage elastase, MMP12, Mmel
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17381
HGNC: HGNC:7158
Homologene: 20547
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Il17a
Name: interleukin 17A
Synonyms: Ctla8, Ctla-8, Il17, IL-17A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16171
HGNC: HGNC:5981
Homologene: 1651
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Cdh24
Name: cadherin-like 24
Synonyms: cadherin 14-like, EY-cadherin, 1700040A22Rik, ENSMUSG00000022188
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239096
VEGA: 14
Homologene: 56951
Pcdhb8
Name: protocadherin beta 8
Synonyms: Pcdhb5C, PcdhbH
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93879
HGNC: HGNC:8690
Homologene: 89038
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Dpep1
Name: dipeptidase 1
Synonyms: MBD
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13479
HGNC: HGNC:3002
Homologene: 80192
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Zfp618
Name: zinc finger protein 618
Synonyms: D430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72701
Homologene: 18975
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Gm1527
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 385263
Homologene: 133976
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Cts3
Name: cathepsin 3
Synonyms: 1600000I23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 117066
VEGA: 13
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11498
Homologene: 86950
Slc35g3
Name: solute carrier family 35, member G3
Synonyms: Amac1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56293
Homologene: 89413
Lrrc61
Name: leucine rich repeat containing 61
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243371
Homologene: 41538
Zbed4
Name: zinc finger, BED type containing 4
Synonyms: 1700009F06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223773
Homologene: 138455
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,733,773 bp
  • T to A, chromosome 2 at 30,301,048 bp
  • T to C, chromosome 2 at 31,409,135 bp
  • T to A, chromosome 2 at 35,162,861 bp
  • A to T, chromosome 2 at 86,554,007 bp
  • A to G, chromosome 2 at 91,654,108 bp
  • T to C, chromosome 2 at 91,931,224 bp
  • T to A, chromosome 2 at 120,050,458 bp
  • G to A, chromosome 2 at 174,093,499 bp
  • T to C, chromosome 3 at 28,918,090 bp
  • C to T, chromosome 4 at 63,132,562 bp
  • T to A, chromosome 4 at 129,951,786 bp
  • G to A, chromosome 4 at 154,980,662 bp
  • T to A, chromosome 5 at 13,523,164 bp
  • C to T, chromosome 6 at 21,967,689 bp
  • C to T, chromosome 6 at 48,568,199 bp
  • A to G, chromosome 6 at 91,745,000 bp
  • G to A, chromosome 6 at 142,628,559 bp
  • C to T, chromosome 7 at 80,285,340 bp
  • T to C, chromosome 7 at 80,368,358 bp
  • A to T, chromosome 8 at 69,101,961 bp
  • G to T, chromosome 8 at 110,571,915 bp
  • C to A, chromosome 8 at 123,199,982 bp
  • T to C, chromosome 9 at 7,354,823 bp
  • G to A, chromosome 9 at 44,953,097 bp
  • A to G, chromosome 9 at 103,328,499 bp
  • T to A, chromosome 9 at 111,391,226 bp
  • G to A, chromosome 10 at 75,245,400 bp
  • A to T, chromosome 11 at 67,253,208 bp
  • A to G, chromosome 11 at 69,760,298 bp
  • A to T, chromosome 11 at 79,953,598 bp
  • A to G, chromosome 11 at 83,946,134 bp
  • T to A, chromosome 11 at 102,255,669 bp
  • A to G, chromosome 11 at 107,111,137 bp
  • C to A, chromosome 12 at 18,531,667 bp
  • C to T, chromosome 12 at 81,420,686 bp
  • GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC to G, chromosome 12 at 85,933,555 bp
  • T to A, chromosome 13 at 9,170,643 bp
  • A to T, chromosome 13 at 61,568,370 bp
  • T to C, chromosome 14 at 26,579,819 bp
  • T to C, chromosome 14 at 54,639,057 bp
  • T to C, chromosome 14 at 78,510,967 bp
  • T to A, chromosome 15 at 88,781,649 bp
  • T to C, chromosome 16 at 35,858,410 bp
  • G to T, chromosome 16 at 96,176,061 bp
  • A to T, chromosome 17 at 23,477,202 bp
  • A to G, chromosome 17 at 23,818,275 bp
  • C to T, chromosome 17 at 46,241,846 bp
  • A to G, chromosome 17 at 67,881,492 bp
  • T to A, chromosome 18 at 37,356,685 bp
  • T to G, chromosome 18 at 80,933,932 bp
  • A to G, chromosome 19 at 38,062,655 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5774 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043373-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.