Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5774Btlr
Stock Number:
043373-MU
Citation ID:
RRID:MMRRC_043373-MU
Other Names:
R5774 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Mdk
Name: midkine
Synonyms: MK, Mek
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17242
HGNC: HGNC:6972
Homologene: 1792
Cep55
Name: centrosomal protein 55
Synonyms: 2700032M20Rik, 1200008O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74107
VEGA: 19
HGNC: HGNC:1161
Homologene: 10019
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, 9530057A13Rik, 4932439K10Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,733,773 bp
  • T to A, chromosome 2 at 30,301,048 bp
  • T to C, chromosome 2 at 31,409,135 bp
  • T to A, chromosome 2 at 35,162,861 bp
  • A to T, chromosome 2 at 86,554,007 bp
  • A to G, chromosome 2 at 91,654,108 bp
  • T to C, chromosome 2 at 91,931,224 bp
  • T to A, chromosome 2 at 120,050,458 bp
  • G to A, chromosome 2 at 174,093,499 bp
  • T to C, chromosome 3 at 28,918,090 bp
  • C to T, chromosome 4 at 63,132,562 bp
  • T to A, chromosome 4 at 129,951,786 bp
  • G to A, chromosome 4 at 154,980,662 bp
  • T to A, chromosome 5 at 13,523,164 bp
  • C to T, chromosome 6 at 21,967,689 bp
  • C to T, chromosome 6 at 48,568,199 bp
  • A to G, chromosome 6 at 91,745,000 bp
  • G to A, chromosome 6 at 142,628,559 bp
  • C to T, chromosome 7 at 80,285,340 bp
  • T to C, chromosome 7 at 80,368,358 bp
  • A to T, chromosome 8 at 69,101,961 bp
  • G to T, chromosome 8 at 110,571,915 bp
  • C to A, chromosome 8 at 123,199,982 bp
  • T to C, chromosome 9 at 7,354,823 bp
  • G to A, chromosome 9 at 44,953,097 bp
  • A to G, chromosome 9 at 103,328,499 bp
  • T to A, chromosome 9 at 111,391,226 bp
  • G to A, chromosome 10 at 75,245,400 bp
  • A to T, chromosome 11 at 67,253,208 bp
  • A to G, chromosome 11 at 69,760,298 bp
  • A to T, chromosome 11 at 79,953,598 bp
  • A to G, chromosome 11 at 83,946,134 bp
  • T to A, chromosome 11 at 102,255,669 bp
  • A to G, chromosome 11 at 107,111,137 bp
  • C to A, chromosome 12 at 18,531,667 bp
  • C to T, chromosome 12 at 81,420,686 bp
  • GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC to G, chromosome 12 at 85,933,555 bp
  • T to A, chromosome 13 at 9,170,643 bp
  • A to T, chromosome 13 at 61,568,370 bp
  • T to C, chromosome 14 at 26,579,819 bp
  • T to C, chromosome 14 at 54,639,057 bp
  • T to C, chromosome 14 at 78,510,967 bp
  • T to A, chromosome 15 at 88,781,649 bp
  • T to C, chromosome 16 at 35,858,410 bp
  • G to T, chromosome 16 at 96,176,061 bp
  • A to T, chromosome 17 at 23,477,202 bp
  • A to G, chromosome 17 at 23,818,275 bp
  • C to T, chromosome 17 at 46,241,846 bp
  • A to G, chromosome 17 at 67,881,492 bp
  • T to A, chromosome 18 at 37,356,685 bp
  • T to G, chromosome 18 at 80,933,932 bp
  • A to G, chromosome 19 at 38,062,655 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5774 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043373-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.