Strain Name:
Stock Number:
Citation ID:
Other Names:
R5774 (G1)
Major Collection:

Strain Information

Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269614
Homologene: 41235
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21366
Homologene: 2291
Name: midkine
Synonyms: MK, Mek
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17242
Homologene: 1792
Name: centrosomal protein 55
Synonyms: 1200008O12Rik, 2700032M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74107
VEGA: 19
Homologene: 10019
Name: nucleoporin 188
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227699
Homologene: 45683
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, Specc1l, 4932439K10Rik, 9530057A13Rik, Cytsa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 217980
Homologene: 18195
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228960
Homologene: 2791
Name: UTP6 small subunit processome component
Synonyms: HCA66, 4732497O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216987
Homologene: 41265
Name: serine/arginine repetitive matrix 2
Synonyms: SRm300, 5033413A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 75956
Name: bromodomain PHD finger transcription factor
Synonyms: Falz, 9430093H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207165
Homologene: 114397
Name: topoisomerase (DNA) II binding protein 1
Synonyms: 2810429C13Rik, 1110031N14Rik, D430026L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235559
Homologene: 38262
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Name: DExD box helicase 52
Synonyms: ROK1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 52, 2700029C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78394
Homologene: 5093
Name: inhibitor of growth family, member 3
Synonyms: 1300013A07Rik, P47ING3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71777
Homologene: 6804
Name: exportin 5
Synonyms: Exp5, 2700038C24Rik, 2410004H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72322
VEGA: 17
Homologene: 69316
Name: ATPase, H+ transporting, lysosomal V1 subunit B2
Synonyms: Atp6b2, HO57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11966
Homologene: 1279
Name: centriolin
Synonyms: b2b1468Clo, IB3/5, Cep1, Cep110, Ma2a8, 6720467O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
Homologene: 38260
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268970
Homologene: 18264
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217216
Homologene: 69368
Name: DENN domain containing 6A
Synonyms: Fam116a, A630054L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 211922
Homologene: 13503
Name: Rho GTPase activating protein 1
Synonyms: p50rhoGAP, Cdc42GAP, B230365D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228359
Homologene: 20909
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219181
Homologene: 8279
Name: RIKEN cDNA 5730507C01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 236366
VEGA: 12
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 1700048H13Rik, D630041K24Rik, STAMP, 2310009M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320244
Homologene: 9013
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 1700034M11Rik, hyrh, hy-3, hy3, 4930545D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Name: SPOC domain containing 1
Synonyms: OTTMUSG00000009522
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 622480
Homologene: 83439
Name: spectrin beta, non-erythrocytic 5
Synonyms: Spnb5, EG640524
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 640524
Homologene: 41150
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, C030048J01Rik, Lba1, LOC235639
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320429
Homologene: 45845
Name: olfactory receptor family 8 subfamily K member 33
Synonyms: Olfr1080, MOR192-1, GA_x6K02T2Q125-48039418-48038477
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258404
Homologene: 104285
Name: matrix metallopeptidase 12
Synonyms: Mmel, MMP12, macrophage elastase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17381
Homologene: 20547
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, Sur2, SUR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20928
Homologene: 56521
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: Semad, SemD, collapsin-1, semaphorin III, sema III
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20346
Homologene: 31358
Name: interleukin 17A
Synonyms: IL-17A, Ctla8, Ctla-8, Il17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16171
Homologene: 1651
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: Minmus, MYH-2B, Myhsf, MM, MHC2B, MyHC-IIb, Minimsc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17884
Homologene: 123880
Name: cadherin-like 24
Synonyms: EY-cadherin, 1700040A22Rik, cadherin 14-like, ENSMUSG00000022188
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239096
VEGA: 14
Homologene: 56951
Name: protocadherin beta 8
Synonyms: Pcdhb5C, PcdhbH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93879
Homologene: 89038
Name: mannosidase 2, alpha 2
Synonyms: 1700052O22Rik, 4931438M07Rik, alpha mannosidase IIx, MX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 140481
Homologene: 55954
Name: dipeptidase 1
Synonyms: MBD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13479
Homologene: 80192
Name: ubiquitination factor E4A
Synonyms: 9930123J21Rik, UFD2b, 4732444G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 140630
Homologene: 3517
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233405
Homologene: 10261
Name: zinc finger protein 618
Synonyms: 2810040O04Rik, D430033D05Rik, Nedd10, 2810031P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72701
Homologene: 18975
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 547253
Homologene: 19697
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 619788
Homologene: 86604
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 385263
Homologene: 133976
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 385668
Homologene: 47978
Name: cathepsin 3
Synonyms: 1600000I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 117066
VEGA: 13
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 11498
Homologene: 86950
Name: solute carrier family 35, member G3
Synonyms: Amac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56293
Homologene: 89413
Name: leucine rich repeat containing 61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243371
Homologene: 41538
Name: zinc finger, BED type containing 4
Synonyms: 1700009F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223773
Homologene: 138455
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,733,773 bp
  • T to A, chromosome 2 at 30,301,048 bp
  • T to C, chromosome 2 at 31,409,135 bp
  • T to A, chromosome 2 at 35,162,861 bp
  • A to T, chromosome 2 at 86,554,007 bp
  • A to G, chromosome 2 at 91,654,108 bp
  • T to C, chromosome 2 at 91,931,224 bp
  • T to A, chromosome 2 at 120,050,458 bp
  • G to A, chromosome 2 at 174,093,499 bp
  • T to C, chromosome 3 at 28,918,090 bp
  • C to T, chromosome 4 at 63,132,562 bp
  • T to A, chromosome 4 at 129,951,786 bp
  • G to A, chromosome 4 at 154,980,662 bp
  • T to A, chromosome 5 at 13,523,164 bp
  • C to T, chromosome 6 at 21,967,689 bp
  • C to T, chromosome 6 at 48,568,199 bp
  • A to G, chromosome 6 at 91,745,000 bp
  • G to A, chromosome 6 at 142,628,559 bp
  • C to T, chromosome 7 at 80,285,340 bp
  • T to C, chromosome 7 at 80,368,358 bp
  • A to T, chromosome 8 at 69,101,961 bp
  • G to T, chromosome 8 at 110,571,915 bp
  • C to A, chromosome 8 at 123,199,982 bp
  • T to C, chromosome 9 at 7,354,823 bp
  • G to A, chromosome 9 at 44,953,097 bp
  • A to G, chromosome 9 at 103,328,499 bp
  • T to A, chromosome 9 at 111,391,226 bp
  • G to A, chromosome 10 at 75,245,400 bp
  • A to T, chromosome 11 at 67,253,208 bp
  • A to G, chromosome 11 at 69,760,298 bp
  • A to T, chromosome 11 at 79,953,598 bp
  • A to G, chromosome 11 at 83,946,134 bp
  • T to A, chromosome 11 at 102,255,669 bp
  • A to G, chromosome 11 at 107,111,137 bp
  • C to A, chromosome 12 at 18,531,667 bp
  • C to T, chromosome 12 at 81,420,686 bp
  • GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC to G, chromosome 12 at 85,933,555 bp
  • T to A, chromosome 13 at 9,170,643 bp
  • A to T, chromosome 13 at 61,568,370 bp
  • T to C, chromosome 14 at 26,579,819 bp
  • T to C, chromosome 14 at 54,639,057 bp
  • T to C, chromosome 14 at 78,510,967 bp
  • T to A, chromosome 15 at 88,781,649 bp
  • T to C, chromosome 16 at 35,858,410 bp
  • G to T, chromosome 16 at 96,176,061 bp
  • A to T, chromosome 17 at 23,477,202 bp
  • A to G, chromosome 17 at 23,818,275 bp
  • C to T, chromosome 17 at 46,241,846 bp
  • A to G, chromosome 17 at 67,881,492 bp
  • T to A, chromosome 18 at 37,356,685 bp
  • T to G, chromosome 18 at 80,933,932 bp
  • A to G, chromosome 19 at 38,062,655 bp
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5774 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043373-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.